АвторТема: Расчет TMRCA по данным полного сиквенса Y-хромосомы  (Прочитано 3623 раз)

0 Пользователей и 1 Гость просматривают эту тему.

Оффлайн ШадАвтор темы

  • Главный модератор
  • *****
  • Сообщений: 6330
  • Страна: ru
  • Рейтинг +1285/-4
  • Ex oriente lux
  • Y-ДНК: Q-Y2750
  • мтДНК: J1c2z
Evaluating the Y chromosomal timescale in human demographic and lineage dating

Wang et al, 2014

Abstract
Y chromosome is a superb tool for inferring human evolution and recent demographic history from a paternal perspective. However, Y chromosomal substitution rates obtained using different modes of calibration vary considerably, and have produced disparate reconstructions of human history. Here, we discuss how substitution rate and date estimates are affected by the choice of different calibration points. We argue that most Y chromosomal substitution rates calculated to date have shortcomings, including a reliance on the ambiguous human-chimpanzee divergence time, insufficient sampling of deep-rooting pedigrees, and using inappropriate founding migrations, although the rates obtained from a single pedigree or calibrated with the peopling of the Americas seem plausible. We highlight the need for using more deep-rooting pedigrees and ancient genomes with reliable dates to improve the rate estimation.

http://www.investigativegenetics.com/content/5/1/12

Оффлайн Nimissin

  • Сообщений: 2356
  • Рейтинг +731/-0
  • Y-ДНК: N-M178 L839+ P298+ M2019+ M2118+ M1991+ M1988+
  • мтДНК: C4b12a
Рекомендую прочитать всем, кто работает со снипами (Big Y, FGC).
Очень хорошая статья, которая расставляет все по местам. Только с одним аргументом я не согласен.
In fact, individuals belonging to haplogroup Q-M3 have also been found in Siberia [20], suggesting the divergent event between Q-M3 and Q-L54*(×M3) probably occurred before the first colonization of Americas.
Мутация М3 все-таки зародилась в Америке, а не в Азии. Нет убедительных доказательств против этого. И скорость субституций (замен) должна быть выше 0.82 х 10^ (-9).
Работая одновременно с SNP и STR данными, вижу, что средняя скорость 10^ (-9) в год на п.н.о. более предпочтительна.
« Последнее редактирование: 14 Сентябрь 2014, 14:08:02 от Nimissin »

Оффлайн ШадАвтор темы

  • Главный модератор
  • *****
  • Сообщений: 6330
  • Страна: ru
  • Рейтинг +1285/-4
  • Ex oriente lux
  • Y-ДНК: Q-Y2750
  • мтДНК: J1c2z
Но опробированная методика пока отсутствует.

Да, отчего же так вот и отсутствует?
Можно создать статистическое распределение любых случайных величин. Субъективно кажется, что прогноз погоды - задача гораздо более сложная, но решаемая.
Правда и оценки ВБОПов походят и будут походить на прогнозы погоды.
*** Не хотелось бы забалтывать раньше времени мой вопрос.
Поэтому повторю его ещё раз:
Цитировать
не могли бы разработчики дать в этой ветке самое большое и самое малое значения приватных снипов для всего множества обработанных гаплотипов, а также соответствующие им субклады на экспериментальном дереве YFull?

Чтобы не забалтывать - отвечаю здесь.
На примере гаплогруппы Q столкнулись с тем, что даже у образцов, протестированных в одной фирме, при выделении одной области измерения, соответствующего исследованию Poznik et al. (2013), имеется разное количество снипов (ветвеобразующих и приватных) от точки ветвления до настоящего времени. Ничем кроме озвученных причин
В первую очередь это связано с качеством прочтения (часто низким), покрытием (разным у BigY, FG Elite и опубликованных академических образцов), а также маппированием (сам в последнем вопросе глубоко не разбираюсь, но есть авторитетное мнение, что с этим вообще дело обстоит не лучшим образом).
это объяснить нельзя.

Оффлайн VVR

  • ...
  • Сообщений: 2462
  • Страна: ua
  • Рейтинг +616/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Количество STR-мутаций(реальных) от одного общего предка при достаточной статистике может различаться у разных гаплотипов примерно в 3,5-4 раза. При этом никаких проблем с маппированием, качеством прочтения и прочем при обычном STR-тестировании нет. Разница объясняется только вероятностным распределением. Разница в количестве SNP-мутаций от общего предка у разных образцов обязательно должна быть. Т.к. снип-мутация тоже событие случайное. Все перечисленные проблемы, кроме разной величины покрытия, также случайные события. Поэтому я считаю, что оценка ВБОП по снип-мутациям(при одинаковом покрытии)  вполне возможна. На мой взгляд, естественно, что по 1-2 образцам такая оценка будет иметь существенную погрешность.

Оффлайн ШадАвтор темы

  • Главный модератор
  • *****
  • Сообщений: 6330
  • Страна: ru
  • Рейтинг +1285/-4
  • Ex oriente lux
  • Y-ДНК: Q-Y2750
  • мтДНК: J1c2z
Как-то не получается дискуссию собрать всю дискуссию в одном месте:(
Начало дискуссии здесь: http://forum.molgen.org/index.php/topic,34.msg253678.html#msg253678
Ниже - принципиальные моменты позиции уважаемого Nimissin

Во-вторых, если бы кошка была собакой, то её бы звали собакой. © По моим поняткам, если на конце терминальной ветви присутствует всего два гаплотипа и у них есть совпадающие снипы, то эти снипы никак не могут полагаться приватными. Они просто дополнительно характеризуют ветвь. Разве не так?
Снипы не сами объявляют себя приватными. Доверяй - но проверяй ;). Сегодня снип приватный, завтра - образует новый субклад.

Так, так, так.

Интересное дельце.

Во-первых, глянул. Глянул только приватные снипы, определённые с наилучшим качеством. Таковых оказалось всего три. Естественно разных. На них я и остановился.

Вопрос с качеством снипов сейчас один из основных. Когда склеиваешь риды длиной 100-150 п.н.о. есть риск вставить в последовательность участок из другой хромосомы. Ведь для такой длины рида гомологичных участков в ДНК человека хоть отбавляй. Особенно между Y и X хромосомами.
Что делать?
Приходится жертвовать частью прочтенной области. "Хорошие" участки, где маппирование производится однозначно и без сомнений - известны. В работе Poznik et al. (2013) была проведена целенаправленная работа по выявлению добротных участков (с точки зрения технологии NGS). Выявили около 10 млн. п.н.о. В приложении к статье есть BED файл, очерчивающий границы пригодных последовательностей. Михаил, для целей настоящего обсуждения предлагаю из 62 упомянутых снипов выбросить снипы, чьи координаты выпадают из области 10 млн.п.н.о., измеренной Poznik et al. (2013). Мне представляется, что многие "приватные" снипы с недостаточным качеством отпадут.
Конечно, это еще не всё.

Но положим.
Положим, что скорость мутаций 0.75 * 10-9 мутации на снип в год.
Корнейчук отстоит от Хоменко на 28 + 34 = 62 мутации.

Итого ВБОП составляет 62 мутации / (0.75 * 10-9 мутаций/год) = 82.7 миллиарда лет?    :o
Скорость рассчитывается на одну пару нуклеотидных оснований. Поэтому необходимо знать общую протяженность измеренных нуклеотидных последовательностей. К сожалению, этот показатель надо высчитывать самому. В среднем область измерений BigY оставляет 10-11 млн. п.н.о. Для упрощения расчетов возьмем 10 млн. Тогда вероятность мутации составляет в среднем 0.75 х 10^ (-9) x 10^ (7) = 7.5 x 10^ (-3) в год. Это в среднем 133 года между двумя последовательными мутациями. Поскольку ГД в нашем примере составляет 62 мутации, то 133 х 62 = 8200 лет.

В начале обсуждения я насчитал 5000 лет. Исходил из того, что 62 мутации выдала группа YFull. Тогда область измерений расширяется примерно до 13 млн. п.н.о. Скорость мутаций я взял равной 10^ (-9).
1/ (10^ (-9) x 1.3 x 10^ (7)) = 77 лет на одну мутацию.
77 х 62 = 5000 лет.

Оффлайн Nimissin

  • Сообщений: 2356
  • Рейтинг +731/-0
  • Y-ДНК: N-M178 L839+ P298+ M2019+ M2118+ M1991+ M1988+
  • мтДНК: C4b12a
После того, как у нас останутся только мутации с координатами из "хорошей" области Y-хромосомы, надо чистить дальше. Внутри области, которую измерили авторы работы Poznik et al. (2013), все равно, хоть и в небольшом числе, встречаются ошибочно маппированные снипы. С ними приходится повозиться. Хорошо, когда они сами себя выдают. Например, снип определен как 50 А и 15 Т. Или при среднем покрытии 60 позиция снипа была прочитана в 20 раз больше, например1200 G.
Очень хорошо, когда есть несколько образцов. Тогда можно по ним сравнить результат маппирования одной и той же позиции.
Подозрительные снипы надо прогонять по утилите BLAT
https://genome.ucsc.edu/cgi-bin/hgBlat?hgsid=373377923_JCSo8Ic3QkPQ8xlHi0P5L1n1ldTP&command=start
Пример.
Есть кандидатура на снип: 18965985 T > G. Прочтение: 6 G.
Позиция снипа находится внутри последовательности
CCAGTTTGCATTCTTAAAAACTACTGATTTCAAGCCTGCCTTCCTT
Закладываем эту последовательность в BLAT. Получаем результат:
Хромосома Y: 97.9%,
Хромосома 18: 100.0 %.
Мы думали, что уникальная последовательность Y-хромосомы не совпадает референсной из-за мутации T > G. А на самом деле в последовательность встроилась цепочка из хромосомы 18, без всяких мутаций. Длина цепочки равна длине рида, т.е. около 100 bp.
Так и приходится оставшиеся после "грубой очистки" кандидатуры тщательно проверять.

Оффлайн Nimissin

  • Сообщений: 2356
  • Рейтинг +731/-0
  • Y-ДНК: N-M178 L839+ P298+ M2019+ M2118+ M1991+ M1988+
  • мтДНК: C4b12a
Важное дополнение. Снип из приведенного примера вызвал подозрение тем, что недалеко от его позиции, в том же риде, образовалась делеция сразу 4-х нуклеотидов (СТТС). Из-за неправильной вставки фрагмента пришлось в одном месте разорвать цепочку. Только тогда она как-то встала на место. Но все равно один нуклеотид не совпал. Образовалась та самая "мутация".

Оффлайн ШадАвтор темы

  • Главный модератор
  • *****
  • Сообщений: 6330
  • Страна: ru
  • Рейтинг +1285/-4
  • Ex oriente lux
  • Y-ДНК: Q-Y2750
  • мтДНК: J1c2z
Интереснейший комментарий VVR в другой теме:
http://forum.molgen.org/index.php/topic,34.msg254557.html#msg254557

Попытался разобраться с теми вопросами, которые поднимал. Был ответ Вертнера в теме YFull. Пересмотрел эту тему, то что касается приватных снипов. Связался с Михалом Милевски,админом гг проекта R1a, который и публиковал деревья-схемы результатов BigY. Разобрался неполностью,но некоторые моменты проясняются.

Михал объяснил критерии качества снипов, которые он применял.  Из результатов ФТДНА берутся снипы “best” or “acceptable” quality. Не берутся инделы, т.е. мутации, где происходит не замена, а инсерция или делеция нуклеотидов. Не берутся снипы с проблемных участков, напр. палиндромных. Т.е происходит фильтрация снипов по качеству. Вероятно подобные критерии используют и другие авторы при калибровке скорости снип-мутаций, на которых ссылался Нимиссин.
Мнение представителя YFull о качестве такой фильтрации:
PS Администраторы проекта "R1a $ subclades" уже давно научились самостоятельно фильтровать тот мусор, который называется "новелями". В результате у них остается 20-30 действительно новых снипов  из 250 "новелей".  ;D

1) Часть таких "новелей" FTDNA - известные снипы разнообразных серий.
2) Часть - реверсные снипы от референса
3) часть - мусор из псевдоаутосомных регионов
4) часть - палиндромы
etc
YFull выдаёт все возможные приватные снипы, но может провести фильтрацию и дать список отфильтрованных снипов. Дальше в цитате есть объснение:
YFS074392   2948547
YFS074399   3489438
YFS074400   3524590
YFS074392   2948547 C->A - мутация в гене LINC0278. В вашем случае в этой позиции прочитано два раза A.
YFS074399   3489438 C->A - В вашем случае в этой позиции прочитано два раза A.
YFS074400   3524590 C->A - В вашем случае в этой позиции прочитано два раза A.
etc
Эти снип вы взяли из группы "ненадёжных", помещенных туда именно по причине малого покрытия - 2X. Обычно надежными признаются снипы с как минимум 4X покрытием. Мы ставим лучшую оченку снипам, имеющим как минимум 5X покрытие.
Группа "ненадёжных" снипов показана только для принятия к сведению. (выделено мной, VVR) В дальнейшем возможно появятся другие семплы, с более качественно проверенными этими областями и вероятно некоторые "ненадёжные" снипы окажутся вполне нормальными, а некоторые уйдут в мусор.
Для филогении, в первую очередь вы должны обращать свое внимание на вкладки "лучшие" и "нормальные" снипы.

Для того, чтобы понять, почему у ФТДНА они не отображены, следует смотреть VCF и BED файлы, которые есть у вас. Предполагаю они выявлены, но имеют статус "REJECTED" именно по причине 2X покрытия.
Кстати, в ответ на сообщение Михаила
Mich Glitch, хочу Вас попросить - не могли бы Вы поделиться данными, которые получите от команды YFull по Вашим J2b-Y? Команда J2a-L24 (к которой и я некоторым образом отношусь) во главе с Ал Абурто  пытается пока сама проанализировать свои данные по FGC и BigY. Было бы полезно иметь Ваши данные, чтоб классифицировать снипы, общие для J2.

Людмила,

Отправил Вам лист своих приватных снипов.

Полный лист всех положительных снипов никак не могу скачать.
Либо обсчёт не закончен.
Либо сервер перегружен.

Попытаюсь опять дня через два.    :)
представители YFull обращают его внимание на необходимость фильтрации приватных снипов:
зря отправили приватные, т.к. они еще не прошли финальной фильттрации  :)

И есть что далее по теме почитать.
http://forum.molgen.org/index.php/topic,34.msg254559.html#msg254559
http://forum.molgen.org/index.php/topic,34.msg254560.html#msg254560

Оффлайн Nimissin

  • Сообщений: 2356
  • Рейтинг +731/-0
  • Y-ДНК: N-M178 L839+ P298+ M2019+ M2118+ M1991+ M1988+
  • мтДНК: C4b12a
Поддерживаю позицию уважаемого VVR. Особенности современной технологии NGS таковы, что в перечень т.н. "приватных" снипов попадает самый разнообразный мусор. Часть его выбрасываем, исключая ненадежные области Y-хромосомы. Оставшиеся кандидатуры обрабатываем вручную, просматривая BAM файлы, сравнивая с родственными гаплотипами и т.д.
Тем не менее, считаю, что оценивать TMRCA по снипам вполне можно.

По опыту обработки индивидуальных Big Y можно сказать, что наиболее проблемными являются инделы. Поэтому их, а также менее редкие MNP (многонуклеотидные полиморфизмы) надо исключать из анализа. На всякий случай, все без исключения.

Оффлайн VVR

  • ...
  • Сообщений: 2462
  • Страна: ua
  • Рейтинг +616/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Хотел бы обратить внимание форумчан, что Mich Glitch, совершенно не разобравшись в вопросе, в теме своего генографического проекта активно пропагандирует фрические(лженаучные) взгляды по поводу оценки TMRCA, он же ВБОП(возраст ближайшего общего  предка), двух гаплотипов по данным их BigY теста.
То что он не разобрался, хорошо видно из нашего общения в этой теме. Даже после того, как я разжевал и разложил по полочкам большинство вопросов,приведя массу цитат форума с пояснениями специалистов YFull, он не удосужился  это внимательно прочесть. Похватал вершки и вроде бы начал что-то немного понимать. Тем не менее, сразу же по своей привычке начал всех, в т.ч. меня, учить, проявляя потрясающее невежество.
То, как он пытался по снипам BigY посчитать возраст Адама, это отдельная история. Сначала не знал какую цифру количества снипов брать, потому что не понимает, что такое все известные снипы и что такое положительные снипы у конкретного семпла. Далее никак не мог уложить две цифры в одно действие. В конце концов получил бредовый результат. И пока я на примере не показал ему как это делается, он так и не сообразил. И это человек, который во всю хвастался тем, что окончил математическую школу. Я уж не знаю. как его туда взяли, может по программе помощи людям с недостаточным математическим мышлением.

Заметьте, я никогда не осуждаю человека за незнание или непонимание каких-то вопросов, всегда готов помочь форумчанам, но если он при этом незнании и непонимании начинает учить других, это вызывает законное возмущение.

Оффлайн VVR

  • ...
  • Сообщений: 2462
  • Страна: ua
  • Рейтинг +616/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Новое его поучение, как обычно, сформулированное в безапелляционной форме здесь.
Я мог бы подробно прокомментировать каждый пункт. С чем-то там можно согласиться с некоторыми оговорками, но есть явно лженаучные высказывания.Остановлюсь на самом бредовом.
д)-вредный бред
з)-математически неграмотный бред
и)шизофренический бред
достаточно важный пункт ж). Его нельзя назвать бредом, но это  ничем не обоснованное предположение. То, что оно ложное я могу доказать.

Начну с пункта и)
и) в контексте попарного исчисления ВБОПов, между:
- отцом и сыном 0.5 поколения (нет общего ближайшего предка для отца и сына, в том смысле, что отец этим самым ближайшим предком для сына и является);
В любом контексте между отцом и сыном 1 поколение. В биологии, популяционной генетике и ДНК-генеалогии, как их разделе. Я уже приводил цитату Большого Энциклопедического Словаря (именно в биологическом контексте) "Поколение - расстояние между отцом и сыном". Не 2 расстояния, не 1/2 расстояния, а именно 1 расстояние. Можно также посмотреть любую работу попгенетиков, где определяется скорость мутаций по парам отец-сын. Среднее количество мутаций в этих парах и является скоростью мутаций на поколение. Не на 2 поколения, не на 1/2 поколения, а именно на поколение. Например. Баллантайн и др.(2010) http://www.sciencedirect.com/science/article/pii/S0002929710004192
Как и во всех таких работах берётся какое-то количество пар отец-сын ("DNA-confirmed father-son pairs"). Определяется количество мутаций в парах. И в результате получают скорость мутаций на поколение ("per generation"). Не на 2 пок., не на полтора или пол поколения, а именно на 1 поколение между отцом и сыном.

Оффлайн VVR

  • ...
  • Сообщений: 2462
  • Страна: ua
  • Рейтинг +616/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
з) при попарной оценке ВБОПов для гаплотипов BigY + Yfull, с использованием в качестве разницы суммы наиболее качественных приватных снипов двух сравниваемых гаплотипов, лучше использовать 0. 021 мутации / год (среднегаплотипная скорость), которая хоть по чему-то реальному выверенная, а не делающая отсылки к непонятно какому возрасту непонятно какой сардинской ветви и пр.;
Как раз пример, когда из-за бредового пункта и) возникает очередной бред.
Как Mich Glitch получил эту цифру? Отвечаю. Ему показалось, что при калиброванной в научных работах скорости 0,007 мутаций в год на 10млн. пар нуклеотидных оснований(примерно столько прочитывает BigY), возраст по парам Корнейчук/Хоменко и Воронцов-Вельяминов/Холмлунд примерно в три раза завышен. Он тупо 0,007 умножил на 3. Во первых, он неправильно считал(см. пункт и). Во-вторых, принятый им ВБОП В.-В./Холмлунд в 40 поколений взят очень приблизительно и для калибровки непригоден. ВБОП К./Х. тоже точно не известен, но предполагается 10 поколений. Допустим. Калибровать по 2 гаплотипам, конечно полная ерунда, но допустим.
Как надо было считать калибровку. От общ. предка до них 10 поколений, значит между ними 20 поколений (см. здесь) 20 поколений умножаем на 32 года(длительность одного поколения). Почему 32 года? В первых, могу сослаться на статистику базы Соренсена.Во-вторых, на отличную работу Темоша-Гаврилова. Если у Mich Glitch что-то хорошо, я так и пишу. Ничего личного.
Между ними 6 приватных мутаций(2+4). 6 мутаций делим на 640лет. Получаем 0,0094 мутации в год на 10млн.пар н.о. Но никак не бредовые 0,021. Естественно, эти 0,0094, полученные по всего лишь одной паре( и то недостаточно достоверной по количеству поколений) никак не опровергают ранее полученную калибровкой цифру 0,007, хотя эту калибровку тоже желательно уточнить.

Оффлайн VVR

  • ...
  • Сообщений: 2462
  • Страна: ua
  • Рейтинг +616/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
д) допускается использование входных величин с любым заданным порогом точности (то есть, возвращаясь к снипам, можно использовать самые лучшие и надёжные, делать калибровку по ним, получать соответствующий доверительный интервал для выходных величин; можно взять все приватные снипы, сделать калибровку по ним, а пороговое значение точности отразится в доверительном интервале выходной величины);
Нельзя брать все приватные снипы, потому что часть из них ненадёжны.Причём даже по данным гаплотипов, протестированных Михаилом видно, что количество этих снипов достаточно произвольное, совершенно непропорциональное возрасту.  Как же можно на таких ненадёжных данных что-то вычислять, давть оценку ВБОП. Нужно брать только снипы Best qual.  Я подробно объяснял это Mich Glitch, но до него не доходит.

Оффлайн VVR

  • ...
  • Сообщений: 2462
  • Страна: ua
  • Рейтинг +616/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
ж) для 43 СТР маркеров и выше лучше использовать скорость 0.0021 мутации / (маркер * поколение), как наиболее выверенную;
Для 43м Соренсена согласен. Эта цифра для них и определена. Для других панелей маркеров - 67м, 111м, 400м BigY не годится. Скорость отдельных маркеров отличается в десятки тысяч раз, усреднение здесь не проходит. Mich Glitch строит предположение ничего не зная, кроме Соренсена. См. ту же статью Баллантайн-2010, на которую я ссылался выше. Проверяем на 67м. По Mich Glitch 0,0021х67= 0,141. В статье только для 58м из 67 (без DYS607 и палиндромных YCAII,CDY,DYF395,DYS413) по почти 2000 пар отец-сын получена скорость 0,148. Уже больше. Из оставшихся нетестированных только 2 копии супербыстрого CDY дадут прибавку, почти как вся панель 1-25. Плюс достаточно быстрый DYS607 да и остальные маркеры. В любом случае скорость 67м получится чуть более 0,200. Т.е., почти  полтора раза больше Соренсеновской. Эти 67м входят и в 111м и в большинстве в те же 400. Поэтому обобщать не стоит.
« Последнее редактирование: 24 Сентябрь 2014, 09:24:09 от VVR »

Оффлайн Mich Glitch

  • Genus regis
  • Сообщений: 37027
  • Страна: ca
  • Рейтинг +3757/-48
  • Y-ДНК: J2b1
  • мтДНК: H6a1a5a
Владимир,

Да откуда Вы можете знать, что я знаю, а чего нет?

Весь смысл моих препирательств с Вами заключается в следующем.
Используемые мною способы прикидочные, простые, сюиминутные. Я это повсюду выпячиваю и даже бравирую этим. Постоянно использую выражения на коленке, прикидки, оценки, щёлкать на счётах и т. д. Типа, раз, два - и готово!
Вы, несмотря на то, что по уровню своего образования, профессионального опыта и просто умению мыслить, со мной и рядом не стояли, всерьёз полагаете, что если потратить в десять раз больше времени; привести кучу цитат из статей, написанных на языке, которого по Вашим собственным словам Вы не знаете; сослаться на кучу "авторитетов". - получите на выходе результат, намного превосходящий мой по точности.

Нет. Не получите.

Одно дело ньютоново F = ma, где для идеального случая можно получить абсолютно точный результат и совсем другое, ну, скажем, прогноз погоды.
Можно сказать, вероятность осадков завтра около 40%. Можно заложиться на три дня. Прогнозам на неделю уже мало кто верит. Ну,а то что на месяц и больше - это для читателей гороскопов. Так же дела обстоят и с ВБОПами.

Есть такое понятие цена / качество. Или в нашем случае затраченные усилия / качество.

То что я делаю, описывается выражениями миллион туда - миллион сюда. Или, и так сойдёт.
То что делаете Вы, описывается точно теми же словами.
Только усилий и времени я трачу в разы меньше и особых каких-то иллюзий не питаю.

Поэтому просто меньше надувайте щёки. Старайтесь говорить понятно и своими  словами. И самое главное, не цепляйтесь ко мне. Уверен, что нет никакой области (что теоретической, что практической) в которой Вы бы меня могли хоть в чём-то превзойти, или превзошли.

Бубните себе просто так, не трепля моего имени. Просто хотя бы потому, чтобы я не обозвал Вас тем, за кого почитаю.

Надеюсь это сообщение успеет дойти до Вас прежде, чем его вымарают.

*** Есть люди, от которых я спокойно выслушиваю фонтаны критики и снисходительные похлопывания по плечу. Но не от Вас. Вы такого права  совершенно ничем не заслужили.

 

© 2007 Молекулярная Генеалогия (МолГен)

Внимание! Все сообщения отражают только мнения их авторов.
Все права на материалы принадлежат их авторам (владельцам) и сетевым изданиям, с которых они взяты.