АвторТема: Просмотр значений снипов в Finch2 браузере  (Прочитано 7744 раз)

0 Пользователей и 1 Гость просматривают эту тему.

Оффлайн mouglleyАвтор темы

  • Модератор
  • *****
  • Сообщений: 7105
  • Страна: hr
  • Рейтинг +434/-7
  • Я знаю, что познаю всё.
    • Записки Маугли
  • Y-ДНК: N1c1-L1025
  • мтДНК: J1c3
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #15 : 23 Февраль 2012, 21:53:27 »
http://finch2.ftdna.com перестал работать.
У них в четверг случается отдых.
Обновление базы, однако.

Можно передохнуть пол суток.
И он начнёт работать.

Оффлайн VVR

  • ...
  • Сообщений: 2456
  • Страна: ua
  • Рейтинг +618/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #16 : 23 Февраль 2012, 22:04:18 »
Но нужно знать, что у старых точно нет такого снипа.
А с маркерами интересно.
А есть там праймеры для Y-STR?
Да это нужно.
По маркерам.Там, если маркер попадает на участок, то это обозначено. А там уже зная стандарт маркера, можно посчитать повторы в последовательности.
Но не по всем маркерам нашёл стандарт. И попадались перевёрнутые с заменой последовательности, как у Вас в примере.

Оффлайн I2a1a

  • ...
  • Сообщений: 10364
  • Страна: ee
  • Рейтинг +761/-8
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #17 : 23 Февраль 2012, 22:23:10 »

Проверил - Build36 -   Y   -    6871472   6871966 
6871472 Это позиция снипа  L1032. Но счет идет с конца.
Но мало того, эта последовательность не только перевернута, но все T заменены A, а C - G.
Т.е. это другая часть Y-хромосомы.

Странно. В Y-сиквенсе геномного билда hg18(Build36) этот регион (495 bp) выглядит следущим образом

>ChrY:6871472..6871966 atctttgggggattggttccaggacctcttgcggatacccaaatgcatgcacactcaaat cctgcagtgtaccctgcaaaacctggtgataggaaaagtcagcactctgtatctggggtt ttgcatcccaaggatactgtattttccttccgaatttgattgtgaatggagaactgagcc ataaggataccaatggtatttattgaaagaaaagtcatgctgtttgattgctgtttgaac cacaaaaaccaagcaaccaaccaaagcccccaaaactaaagctttaaaaaccaatatctg gagaataaaccaaaaccaactaaagcatgaagatggtctaactcagaatgcccagtagaa ctttctaccatatggaaatattttgtatctgtgtagcctcattgccacagctggctaagg gcacaatgggccaagtcatccttactaggcagtgtcagccacactgggccatgtcagcca caccagaccacactg

И, cоотвественно, реверсивная комплиментарная цепочка (strand -)

>ChrY:6871472..6871966 (reverse complemented) cagtgtggtctggtgtggctgacatggcccagtgtggctgacactgcctagtaaggatga cttggcccattgtgcccttagccagctgtggcaatgaggctacacagatacaaaatattt ccatatggtagaaagttctactgggcattctgagttagaccatcttcatgctttagttgg ttttggtttattctccagatattggtttttaaagctttagttttgggggctttggttggt tgcttggtttttgtggttcaaacagcaatcaaacagcatgacttttctttcaataaatac cattggtatccttatggctcagttctccattcacaatcaaattcggaaggaaaatacagt atccttgggatgcaaaaccccagatacagagtgctgacttttcctatcaccaggttttgc agggtacactgcaggatttgagtgtgcatgcatttgggtatccgcaagaggtcctggaac caatcccccaaagat

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • Модератор
  • *****
  • Сообщений: 8443
  • Страна: ar
  • Рейтинг +957/-8
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #18 : 23 Февраль 2012, 22:36:00 »

Проверил - Build36 -   Y   -    6871472   6871966 
6871472 Это позиция снипа  L1032. Но счет идет с конца.
Но мало того, эта последовательность не только перевернута, но все T заменены A, а C - G.
Т.е. это другая часть Y-хромосомы.

Странно. В Y-сиквенсе геномного билда hg18(Build36) этот регион (495 bp) выглядит следущим образом

>ChrY:6871472..6871966 atctttgggggattggttccaggacctcttgcggatacccaaatgcatgcacactcaaat cctgcagtgtaccctgcaaaacctggtgataggaaaagtcagcactctgtatctggggtt ttgcatcccaaggatactgtattttccttccgaatttgattgtgaatggagaactgagcc ataaggataccaatggtatttattgaaagaaaagtcatgctgtttgattgctgtttgaac cacaaaaaccaagcaaccaaccaaagcccccaaaactaaagctttaaaaaccaatatctg gagaataaaccaaaaccaactaaagcatgaagatggtctaactcagaatgcccagtagaa ctttctaccatatggaaatattttgtatctgtgtagcctcattgccacagctggctaagg gcacaatgggccaagtcatccttactaggcagtgtcagccacactgggccatgtcagcca caccagaccacactg

И, cоотвественно, реверсивная комплиментарная цепочка (strand -)

>ChrY:6871472..6871966 (reverse complemented) cagtgtggtctggtgtggctgacatggcccagtgtggctgacactgcctagtaaggatga cttggcccattgtgcccttagccagctgtggcaatgaggctacacagatacaaaatattt ccatatggtagaaagttctactgggcattctgagttagaccatcttcatgctttagttgg ttttggtttattctccagatattggtttttaaagctttagttttgggggctttggttggt tgcttggtttttgtggttcaaacagcaatcaaacagcatgacttttctttcaataaatac cattggtatccttatggctcagttctccattcacaatcaaattcggaaggaaaatacagt atccttgggatgcaaaaccccagatacagagtgctgacttttcctatcaccaggttttgc agggtacactgcaggatttgagtgtgcatgcatttgggtatccgcaagaggtcctggaac caatcccccaaagat

У Вас лишняя буковка.

Оффлайн I2a1a

  • ...
  • Сообщений: 10364
  • Страна: ee
  • Рейтинг +761/-8
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #19 : 23 Февраль 2012, 23:16:56 »

Оффлайн Eugene

  • Санктпетербурхъ
  • Сообщений: 6778
  • Страна: th
  • Рейтинг +1081/-41
    • N1c1 Y-DNA Project
  • Y-ДНК: N-BY32524
  • мтДНК: U-C1341T
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #20 : 24 Февраль 2012, 08:38:49 »
Нашел там такой кусок

Проверил - Build36 -   Y   -    6871472   6871966 
6871472 Это позиция снипа  L1032. Но счет идет с конца.
Но мало того, эта последовательность не только перевернута, но все T заменены A, а C - G.
Т.е. это другая часть Y-хромосомы.

Потому что Вы открыли комплементарную цепочку
а надо

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • Модератор
  • *****
  • Сообщений: 8443
  • Страна: ar
  • Рейтинг +957/-8
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #21 : 24 Февраль 2012, 08:58:36 »
Нашел там такой кусок

Проверил - Build36 -   Y   -    6871472   6871966 
6871472 Это позиция снипа  L1032. Но счет идет с конца.
Но мало того, эта последовательность не только перевернута, но все T заменены A, а C - G.
Т.е. это другая часть Y-хромосомы.

Потому что Вы открыли комплементарную цепочку
а надо
Жаль. финч так и не работает.

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • Модератор
  • *****
  • Сообщений: 8443
  • Страна: ar
  • Рейтинг +957/-8
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #22 : 24 Февраль 2012, 09:00:22 »
Нашел там такой кусок

Проверил - Build36 -   Y   -    6871472   6871966 
6871472 Это позиция снипа  L1032. Но счет идет с конца.
Но мало того, эта последовательность не только перевернута, но все T заменены A, а C - G.
Т.е. это другая часть Y-хромосомы.

Потому что Вы открыли комплементарную цепочку
а надо
Жаль. финч так и не работает.
Наконец-то заработал.

Оффлайн Eugene

  • Санктпетербурхъ
  • Сообщений: 6778
  • Страна: th
  • Рейтинг +1081/-41
    • N1c1 Y-DNA Project
  • Y-ДНК: N-BY32524
  • мтДНК: U-C1341T
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #23 : 24 Февраль 2012, 09:00:26 »
Жаль. финч так и не работает.
Это очень часто бывает. Особенно вкладка Chromats- она тормозит абсолютно всегда.

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • Модератор
  • *****
  • Сообщений: 8443
  • Страна: ar
  • Рейтинг +957/-8
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #24 : 24 Февраль 2012, 09:07:24 »
В конце первой цепочки и в начале второй

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • Модератор
  • *****
  • Сообщений: 8443
  • Страна: ar
  • Рейтинг +957/-8
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #25 : 24 Февраль 2012, 09:44:22 »
Жаль. финч так и не работает.
Это очень часто бывает. Особенно вкладка Chromats- она тормозит абсолютно всегда.
Все получилось.
Система работает.
L1025 - 73958 Crowther G-  180947 Lithuania C+
Но у Валихана еще ничего не показывает.

Оффлайн Valikhan

  • Группа N
  • *
  • Сообщений: 2193
  • Страна: kz
  • Рейтинг +102/-1
  • Ysearch 63CDM. Mitosearch EEVT3
    • Turkic World
  • Y-ДНК: N1c1d1 - L1034 (L1032, L1033)
  • мтДНК: B5a1a
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #26 : 24 Февраль 2012, 13:05:51 »
Жаль. финч так и не работает.
Это очень часто бывает. Особенно вкладка Chromats- она тормозит абсолютно всегда.
Все получилось.
Система работает.
L1025 - 73958 Crowther G-  180947 Lithuania C+
Но у Валихана еще ничего не показывает.

Все данные, в т.ч. хроматограмма, уже загружены в мой профиль. Админы могут скачать.
У меня инет сейчас медленный, выложить сам не смогу, поэтому если нужно или попросят, то можете опубликовать все данные в открытом доступе.

Оффлайн I2a1a

  • ...
  • Сообщений: 10364
  • Страна: ee
  • Рейтинг +761/-8
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #27 : 24 Февраль 2012, 14:27:21 »
В конце первой цепочки и в начале второй

Нет сиквенс совсем иной


© 2007 Молекулярная Генеалогия (МолГен)

Внимание! Все сообщения отражают только мнения их авторов.
Все права на материалы принадлежат их авторам (владельцам) и сетевым изданиям, с которых они взяты.