АвторТема: Просмотр значений снипов в Finch2 браузере  (Прочитано 7739 раз)

0 Пользователей и 1 Гость просматривают эту тему.

Оффлайн mouglleyАвтор темы

  • Модератор
  • *****
  • Сообщений: 7105
  • Страна: hr
  • Рейтинг +434/-7
  • Я знаю, что познаю всё.
    • Записки Маугли
  • Y-ДНК: N1c1-L1025
  • мтДНК: J1c3
Проверил хроматограммы у себя, Sasha39, Kalio  и литовца 180947 и результат, что снип L1027 у нас точно отрицательный, т.к. этот участок у нас тестировался.

На рисунке стрелочкой обозначено наше предковое гуанин, а у литовца 180947 там цитозин.
Уважаемый Eugene, не создадите тему, каким образом можно просмотреть гаплотипы, прошедшие WTY на снипы, обнаруженные позже их анализа в браузере?
По пунктам.

У меня не получается.

Кстати, не могли бы Вы поглядеть и значения для остальных, прошедших WTY снипов в красных полях таблички?
Включая LLY22g

Оффлайн Eugene

  • Санктпетербурхъ
  • Сообщений: 6778
  • Страна: th
  • Рейтинг +1081/-41
    • N1c1 Y-DNA Project
  • Y-ДНК: N-BY32524
  • мтДНК: U-C1341T
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #1 : 23 Февраль 2012, 19:29:09 »
Проверил хроматограммы у себя, Sasha39, Kalio  и литовца 180947 и результат, что снип L1027 у нас точно отрицательный, т.к. этот участок у нас тестировался.

На рисунке стрелочкой обозначено наше предковое гуанин, а у литовца 180947 там цитозин.
Уважаемый Eugene, не создадите тему, каким образом можно просмотреть гаплотипы, прошедшие WTY на снипы, обнаруженные позже их анализа в браузере?
По пунктам.

У меня не получается.

Кстати, не могли бы Вы поглядеть и значения для остальных, прошедших WTY снипов в красных полях таблички?
Включая LLY22g
Уважаемый Mouggley,
Способа есть два:
1) В ручном режиме посмотреть в Finch2 сервере (в принципе самый быстрый и простой вариант, не трубующий дополнительного ПО) полученные последовательности по отсеквенированным участкам. Т.е. например со снипом L1027.
a) Открываем вкладку SNP-Info в том же Finch2 и набрав в поиск L1027 смотрим на каком участке Y-хромосомы он найден. В нашем случае это P203M. Или открываем весь список полученных результутов по снипам литовца 180947 и находим этот наш снип L1027 и видим, что это в классификации FTDNA участок E08_sP203M307.
б) Открываем в Finch2 вкладку Chromats и ищем GRC литовца 180947. В нашем случае это GRC11068267. После того как нашли- выбираем для отображения именно его GRC11068267. Далее открываем для отображения именно интересующий нас участок E08_sP203M307 и получаем нуклеотидную последовательность литовца 180947.
в) Далее параллельно проделываем те же процедуры но у того WTY участника у которого не было заказа на этот снип, но мы желаем знать его результат (это если этот участок у него был протестирован конечно)
г) Сравнимаем их последовательности (можно просто путем копирования в Блокнот и сравнения понуклеотидно).
2) Если есть трим хроматограммы (только если участик WTY подключен к администрируемому проекту) то просто скачиваем все эти файлы. Потом смотрим также на каком участке снип и открываем этот же участок у контрольного WTY-учасника и сравниваем их. Можно хоть 10 персон одновременно загрузить и сравнить. Для этого только требуется программа для чтения и сравнения нуклеотидных последовательностей. У меня давно стоит DNA-Baser, но в Инете их полно всяких разных, которые наверно и лучше.

Вот в принципе и все - если еще какие-то вопросы возникнут по ходу, то спрашивайте.

P.S. Просмотреть сейчас все запрошенные Вами снипы у меня просто нет времени. Пока смотрю только наиболее принципиальные снипы хотя бы для L550.  :)
« Последнее редактирование: 23 Февраль 2012, 19:40:25 от Eugene »

Оффлайн mouglleyАвтор темы

  • Модератор
  • *****
  • Сообщений: 7105
  • Страна: hr
  • Рейтинг +434/-7
  • Я знаю, что познаю всё.
    • Записки Маугли
  • Y-ДНК: N1c1-L1025
  • мтДНК: J1c3
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #2 : 23 Февраль 2012, 19:48:55 »
Огромное спасибо!

Буду тренироваться.

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • Модератор
  • *****
  • Сообщений: 8443
  • Страна: ar
  • Рейтинг +957/-8
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #3 : 23 Февраль 2012, 20:04:23 »
Т.е. можно посмотреть наличие новых снипов у старых WTYшников?
Например, какое у Crowther значение L1032, L1033 и L1034?

Оффлайн mouglleyАвтор темы

  • Модератор
  • *****
  • Сообщений: 7105
  • Страна: hr
  • Рейтинг +434/-7
  • Я знаю, что познаю всё.
    • Записки Маугли
  • Y-ДНК: N1c1-L1025
  • мтДНК: J1c3
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #4 : 23 Февраль 2012, 20:07:48 »
Сегодня пробовать не буду.

Завтра на свежую голову.

А то как-то ухандокался искать значение L220 для Каллио.
Пишут, что плюс, а я его не нахожу.

Замечательную забаву для нас придумал Евгений.
Огромное ему за это спасибо.

Оффлайн Eugene

  • Санктпетербурхъ
  • Сообщений: 6778
  • Страна: th
  • Рейтинг +1081/-41
    • N1c1 Y-DNA Project
  • Y-ДНК: N-BY32524
  • мтДНК: U-C1341T
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #5 : 23 Февраль 2012, 20:11:53 »
Т.е. можно посмотреть наличие новых снипов у старых WTYшников?
Например, какое у Crowther значение L1032, L1033 и L1034?
Можно - путь я описал выше.
Также ввиду уточнение, что если на старом тестируемом участке вдруг обнаружен новый снип, как например получилось со снипом L1027 у литовца 180947, то у предыдущих участников возможны три варианта:
1) Участок нового тестироемого слегка расширился и найден новый снип. (Возможно редко)
2) У всех ранее тестированных в этом месте просто нет снипа, т.е. SNP L1027- (99% случаев)
3) Не замечен снип который на самом деле есть у ранее тестированных. (практически исключено)
« Последнее редактирование: 23 Февраль 2012, 20:27:11 от Eugene »

Оффлайн mouglleyАвтор темы

  • Модератор
  • *****
  • Сообщений: 7105
  • Страна: hr
  • Рейтинг +434/-7
  • Я знаю, что познаю всё.
    • Записки Маугли
  • Y-ДНК: N1c1-L1025
  • мтДНК: J1c3
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #6 : 23 Февраль 2012, 20:17:20 »
А мы - таки лучшие.
(Правда, у нас филогения довольно-таки не требует 111 маркеров, ведь, люди мы недавние на Севере, однако.)

Я читал, что Майка этим пользуется, Томас, тут - конечно - сам ведь придумал.

Думаю, с помощью браузера и мы вместе что-нибудь выудим интересное.

Надо будет составить вопросный список по всем интересным маркерам, а не только тем, которые указывают в WTY.

И 23andme проверить нужно.
У Хоммика три снипа там.

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • Модератор
  • *****
  • Сообщений: 8443
  • Страна: ar
  • Рейтинг +957/-8
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #7 : 23 Февраль 2012, 20:23:27 »
А мы - таки лучшие.
(Правда, у нас филогения довольно-таки не требует 111 маркеров, ведь, люди мы недавние на Севере, однако.)

Я читал, что Майка этим пользуется, Томас, тут - конечно - сам ведь придумал.

Думаю, с помощью браузера и мы вместе что-нибудь выудим интересное.

Надо будет составить вопросный список по всем интересным маркерам, а не только тем, которые указывают в WTY.

И 23andme проверить нужно.
У Хоммика три снипа там.
Список снипов нужно подготовить к понедельнику.

Оффлайн mouglleyАвтор темы

  • Модератор
  • *****
  • Сообщений: 7105
  • Страна: hr
  • Рейтинг +434/-7
  • Я знаю, что познаю всё.
    • Записки Маугли
  • Y-ДНК: N1c1-L1025
  • мтДНК: J1c3
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #8 : 23 Февраль 2012, 20:25:08 »
Список снипов нужно подготовить к понедельнику.
Завтра пороюсь.

Оффлайн mouglleyАвтор темы

  • Модератор
  • *****
  • Сообщений: 7105
  • Страна: hr
  • Рейтинг +434/-7
  • Я знаю, что познаю всё.
    • Записки Маугли
  • Y-ДНК: N1c1-L1025
  • мтДНК: J1c3
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #9 : 23 Февраль 2012, 20:28:17 »
Думаю, нам надо будет создать ёксель-лист в гугеле и там излагать варианты интерпретаций анализа каждого из нас.
Я, Владимир, Евгений.

Должна быть проверка несколькими людьми.

Кто ещё будет просматривать браузер, тому можно дать право редактирования, остальным - просмотра.

Оффлайн VVR

  • ...
  • Сообщений: 2456
  • Страна: ua
  • Рейтинг +618/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #10 : 23 Февраль 2012, 20:56:43 »
Я уже так просматривал и даже для Леслы определил значения нескольких маркеров 68-111, которые нашёл. У него тогда ещё не было. Но дело в том, что там ведь не все участки. И если новый снип на участке, который у старого участника WTY не секвенировался, то ничего не получится.
Поэтому Евгений прав. Практически 100% , что у старых участников просто нет этого снипа или участок не секвенировался.

Оффлайн mouglleyАвтор темы

  • Модератор
  • *****
  • Сообщений: 7105
  • Страна: hr
  • Рейтинг +434/-7
  • Я знаю, что познаю всё.
    • Записки Маугли
  • Y-ДНК: N1c1-L1025
  • мтДНК: J1c3
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #11 : 23 Февраль 2012, 21:10:35 »

Согласен.

Но самое приятное в том, что у следующего тестируемого в WTY могут не указать снип, выявленный ранее, а ведь он на уже исследованном участке.

Значит, его можно поискать в браузере.

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • Модератор
  • *****
  • Сообщений: 8443
  • Страна: ar
  • Рейтинг +957/-8
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #12 : 23 Февраль 2012, 21:20:40 »
Я уже так просматривал и даже для Леслы определил значения нескольких маркеров 68-111, которые нашёл. У него тогда ещё не было. Но дело в том, что там ведь не все участки. И если новый снип на участке, который у старого участника WTY не секвенировался, то ничего не получится.
Поэтому Евгений прав. Практически 100% , что у старых участников просто нет этого снипа или участок не секвенировался.
Но нужно знать, что у старых точно нет такого снипа.
А с маркерами интересно.
А есть там праймеры для Y-STR?

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • Модератор
  • *****
  • Сообщений: 8443
  • Страна: ar
  • Рейтинг +957/-8
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #13 : 23 Февраль 2012, 21:28:09 »
Нашел там такой кусок

GRC012523_WTY_N07_sV84_R_30256_
AGGTCTAATTTAGCTATATG TGTCATTTCT CTCTGCCTCA GATGAAAACT ACAGTCAGAAAAAAAGGAGGAGGGATGGAATTTAAGAACACGTCTTAGTC TAAGCCCCAT CTCCCTTATTTTAAAAAAGG GGGAGTCAGT GAGAATATGA TGGTGATATTAATGCATATTCTCTGCAGAAGTCTCTGGATGGCAAGTTCC CTATATCCTT ATCTCCTAAG AGCTTCTGAG TGCCTATGAAAAACACAAGG AGGTATTAAA TGACTCTGGA AATAGTTTGG AGACCTTGTT CTAAAAGGCT
TCTTCCAGAC ATTTGAGTGC CCCTGGCTGA CTGCACCACT ATCTGTCTCC CCAGTGAACACATCCAGTCC CCAGCACTAT ATCCCAGATG TCTCCAGCCC CTGCCCTCTA GAGCTCCTTACTCATCCCTG CATGGCCTGC ATGACTTGGC CACTTGGAGG TCCAAGCAGC ATCTTAAATGTGGCATGCCTACAGT
Проверил - Build36 -   Y   -    6871472   6871966 
6871472 Это позиция снипа  L1032. Но счет идет с конца.
Но мало того, эта последовательность не только перевернута, но все T заменены A, а C - G.
Т.е. это другая часть Y-хромосомы.

 

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • Модератор
  • *****
  • Сообщений: 8443
  • Страна: ar
  • Рейтинг +957/-8
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Просмотр значений снипов в Finch2 браузере
« Ответ #14 : 23 Февраль 2012, 21:47:44 »
http://finch2.ftdna.com перестал работать.

 

© 2007 Молекулярная Генеалогия (МолГен)

Внимание! Все сообщения отражают только мнения их авторов.
Все права на материалы принадлежат их авторам (владельцам) и сетевым изданиям, с которых они взяты.