АвторТема: Z93*  (Прочитано 49586 раз)

0 Пользователей и 1 Гость просматривают эту тему.

Оффлайн Lesla

  • Главный модератор
  • *****
  • Сообщений: 9153
  • Страна: ru
  • Рейтинг +2381/-9
  • FTDNA: 154400 (Big Y - 283049)
  • Y-ДНК: R1a-YP682 (VK06+)
Re: Z93*
« Ответ #225 : 01 Ноябрь 2015, 21:11:13 »
346249 азербаджанский проект занесите в семаргл
Внес.

Оффлайн SemarglАвтор темы

  • "El sueño de la razón produce monstruos" ©
  • Модератор
  • *****
  • Сообщений: 5492
  • Страна: hr
  • Рейтинг +2963/-5
  • www.semargl.me
    • www.semargl.me
  • Y-ДНК: R1a [CTS3402+]
  • мтДНК: U4a2g
Re: Z93*
« Ответ #226 : 11 Декабрь 2015, 14:10:46 »
#312482 / Zyatkov / R1a-Z93+ (Z94-) KMS149+
KMS - снипы от админа Башкирского проекта. Еще один положительный на этот снип - #360682.
Минус только в том, что KMS149 находится в регионе DYZ19 и есть большая вероятность того, что этот снип будет иметь неадекватные результаты в FTDNA.
К примеру Томас Кран не берет такие снипы для тестирования в YSeq. Будем надеяться что FTDNA смогли подобрать нормальные праймеры.

Оффлайн Evg33

  • Сообщений: 404
  • Страна: ru
  • Рейтинг +27/-0
  • FTDNA: 312482
    • RusNavi
  • Y-ДНК: R-KMS132+ (Z93+,Z94-,KMS149+)
  • мтДНК: H11a1
Re: Z93*
« Ответ #227 : 11 Декабрь 2015, 14:51:19 »
Semargl: Спасибо ! 312482 моё. KMS149 позеленело у меня. R-KMS149 теперь я получается ?

проверил на yfull.com :)
ChrY position:   22270217 (+strand)
Reads:   37
Position data:   36A 1T
Weight for A:   0.971181556196
Weight for T:   0.028818443804
Probability of error:   0.0407554340742 (0<->1)
Sample allele:   A
Reference (hg19) allele:   T
Known SNPs at this position:   KMS149 (T->A) Rating for known SNP
Reference sequence (100bp):   TAGTGGTGAGCGTTACAGCACTTACGTTGTTATGTCCAGAGTTTGTAACT
 T
TAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTGAC
(22270166-22270267)
« Последнее редактирование: 11 Декабрь 2015, 14:58:11 от Evg33 »

Оффлайн Таракан

  • "На стяге твоем такой же кот, лишь только цвет другой" (с)
  • Сообщений: 2129
  • Страна: ru
  • Рейтинг +260/-0
    • Татарский ДНК-проект "Идель"
  • Y-ДНК: R1a-YP5233
  • мтДНК: U4 (Ulrike)
Re: Z93*
« Ответ #228 : 09 Январь 2016, 23:55:39 »
Подозреваю, что начинает образовываться новый кластер (или ветвь) под Z93:

168204 Kasenov
13 24 15 11 10-13 12 12 11 13 11 30 15 9-10 11 11 24 14 20 34 12-15-15-17 12 12 19-23 16 15 19 18 34-38 12 11

386038 Khisamov
13 24 15 11 10-13 12 12 11 13 11 30 15 9-10 11 11 24 14 20 33 12-15-15-17 12 12 19-23 16 15 19 18 34-38 12 11

424404 Abdurzakov
13 24 15 11 10-13 12 12 11 13 11 30 15 9-10 11 11 24 14 20 33 12-12-15-15 12 12 19-23 16 15 18 18 35-38 12 11

DYS464 у Абдурзакова думаю не кретичен и реально он ближе к Хисамову и Касенову.


Оффлайн Таракан

  • "На стяге твоем такой же кот, лишь только цвет другой" (с)
  • Сообщений: 2129
  • Страна: ru
  • Рейтинг +260/-0
    • Татарский ДНК-проект "Идель"
  • Y-ДНК: R1a-YP5233
  • мтДНК: U4 (Ulrike)
Re: Z93*
« Ответ #229 : 10 Январь 2016, 00:35:04 »
Подозреваю, что начинает образовываться новый кластер (или ветвь) под Z93:

168204 Kasenov
13 24 15 11 10-13 12 12 11 13 11 30 15 9-10 11 11 24 14 20 34 12-15-15-17 12 12 19-23 16 15 19 18 34-38 12 11

386038 Khisamov
13 24 15 11 10-13 12 12 11 13 11 30 15 9-10 11 11 24 14 20 33 12-15-15-17 12 12 19-23 16 15 19 18 34-38 12 11

424404 Abdurzakov
13 24 15 11 10-13 12 12 11 13 11 30 15 9-10 11 11 24 14 20 33 12-12-15-15 12 12 19-23 16 15 18 18 35-38 12 11

DYS464 у Абдурзакова думаю не кретичен и реально он ближе к Хисамову и Касенову.

330727 Tamyan-77 Bashkir
13 24 15 11 10-13 12 12 11 13 11 30 15 9-10 11 11 24 14 20 33 12-14-15-17 12 12 19-23 16 15 19 18 35-38 12 11

Ну, собственно говоря, в проекте R1a и субклады Хисамова и Касенова объединили в 9. M420>M459>M198>M417>Z645>Z93-Q Tatar-Bashkir-Kazakh cluster (more STRs and Z94 or Big Y needed)
Осталось туда добавить Абдурзакова и Тамьяна.

Оффлайн Balkan

  • Сообщений: 81
  • Страна: bg
  • Рейтинг +27/-0
  • Y-ДНК: R1a-CTS456-YP617-YP123126
  • мтДНК: U4c1a
Re: Z93*
« Ответ #230 : 23 Январь 2016, 23:59:21 »
Мой родственик из Болгарий -364878 заказал Снип пак в ФТДНА. Резултат:
Z93->Z94->Z2123->Y934->Y15121. :)

Оффлайн Lesla

  • Главный модератор
  • *****
  • Сообщений: 9153
  • Страна: ru
  • Рейтинг +2381/-9
  • FTDNA: 154400 (Big Y - 283049)
  • Y-ДНК: R1a-YP682 (VK06+)
Re: Z93*
« Ответ #231 : 24 Январь 2016, 00:14:29 »
Мой родственик из Болгарий -364878 заказал Снип пак в ФТДНА. Резултат:
Z93->Z94->Z2123->Y934->Y15121. :)
Поздравляю!
Выделил под него новую ветвь в базе Семаргла :)
Там у Y934+ целый куст ветвей образовался.

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • ...
  • Сообщений: 8730
  • Страна: gt
  • Рейтинг +742/-7
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Z93*
« Ответ #232 : 24 Январь 2016, 21:12:19 »
Подозреваю, что начинает образовываться новый кластер (или ветвь) под Z93:

168204 Kasenov
13 24 15 11 10-13 12 12 11 13 11 30 15 9-10 11 11 24 14 20 34 12-15-15-17 12 12 19-23 16 15 19 18 34-38 12 11

386038 Khisamov
13 24 15 11 10-13 12 12 11 13 11 30 15 9-10 11 11 24 14 20 33 12-15-15-17 12 12 19-23 16 15 19 18 34-38 12 11

424404 Abdurzakov
13 24 15 11 10-13 12 12 11 13 11 30 15 9-10 11 11 24 14 20 33 12-12-15-15 12 12 19-23 16 15 18 18 35-38 12 11

DYS464 у Абдурзакова думаю не кретичен и реально он ближе к Хисамову и Касенову.
На Z93 кого-нибудь проверяли?

Оффлайн Таракан

  • "На стяге твоем такой же кот, лишь только цвет другой" (с)
  • Сообщений: 2129
  • Страна: ru
  • Рейтинг +260/-0
    • Татарский ДНК-проект "Идель"
  • Y-ДНК: R1a-YP5233
  • мтДНК: U4 (Ulrike)
Re: Z93*
« Ответ #233 : 24 Январь 2016, 21:17:45 »
Подозреваю, что начинает образовываться новый кластер (или ветвь) под Z93:

168204 Kasenov
13 24 15 11 10-13 12 12 11 13 11 30 15 9-10 11 11 24 14 20 34 12-15-15-17 12 12 19-23 16 15 19 18 34-38 12 11

386038 Khisamov
13 24 15 11 10-13 12 12 11 13 11 30 15 9-10 11 11 24 14 20 33 12-15-15-17 12 12 19-23 16 15 19 18 34-38 12 11

424404 Abdurzakov
13 24 15 11 10-13 12 12 11 13 11 30 15 9-10 11 11 24 14 20 33 12-12-15-15 12 12 19-23 16 15 18 18 35-38 12 11

DYS464 у Абдурзакова думаю не кретичен и реально он ближе к Хисамову и Касенову.
На Z93 кого-нибудь проверяли?

У башкира из Тамьянов он в плюсе.

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • ...
  • Сообщений: 8730
  • Страна: gt
  • Рейтинг +742/-7
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Z93*
« Ответ #234 : 24 Январь 2016, 21:23:22 »
Подозреваю, что начинает образовываться новый кластер (или ветвь) под Z93:

168204 Kasenov
13 24 15 11 10-13 12 12 11 13 11 30 15 9-10 11 11 24 14 20 34 12-15-15-17 12 12 19-23 16 15 19 18 34-38 12 11

386038 Khisamov
13 24 15 11 10-13 12 12 11 13 11 30 15 9-10 11 11 24 14 20 33 12-15-15-17 12 12 19-23 16 15 19 18 34-38 12 11

424404 Abdurzakov
13 24 15 11 10-13 12 12 11 13 11 30 15 9-10 11 11 24 14 20 33 12-12-15-15 12 12 19-23 16 15 18 18 35-38 12 11

DYS464 у Абдурзакова думаю не кретичен и реально он ближе к Хисамову и Касенову.
На Z93 кого-нибудь проверяли?

У башкира из Тамьянов он в плюсе.
Нигде не вижу этого.
Какой проект?

Оффлайн Таракан

  • "На стяге твоем такой же кот, лишь только цвет другой" (с)
  • Сообщений: 2129
  • Страна: ru
  • Рейтинг +260/-0
    • Татарский ДНК-проект "Идель"
  • Y-ДНК: R1a-YP5233
  • мтДНК: U4 (Ulrike)
Re: Z93*
« Ответ #235 : 24 Январь 2016, 21:28:44 »
Нигде не вижу этого.
Какой проект?

Был в башкирском проекте Муратова.

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • ...
  • Сообщений: 8730
  • Страна: gt
  • Рейтинг +742/-7
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Z93*
« Ответ #236 : 24 Январь 2016, 21:37:29 »
Нигде не вижу этого.
Какой проект?

Был в башкирском проекте Муратова.
Панель снипов там закрыта.

Оффлайн Истяк

  • Сообщений: 214
  • Страна: ru
  • Рейтинг +34/-0
  • Y-ДНК: R-Y5977
Re: Z93*
« Ответ #237 : 25 Январь 2016, 11:07:01 »
Там у Y934+ целый куст ветвей образовался.

По Рашид-ад-Дин-у, у татар было шесть племен, вот они и проявились - 5+1   ;D

Оффлайн SemarglАвтор темы

  • "El sueño de la razón produce monstruos" ©
  • Модератор
  • *****
  • Сообщений: 5492
  • Страна: hr
  • Рейтинг +2963/-5
  • www.semargl.me
    • www.semargl.me
  • Y-ДНК: R1a [CTS3402+]
  • мтДНК: U4a2g
Re: Z93*
« Ответ #238 : 19 Апрель 2016, 11:23:15 »
Semargl: Спасибо ! 312482 моё. KMS149 позеленело у меня. R-KMS149 теперь я получается ?

проверил на yfull.com :)
ChrY position:   22270217 (+strand)
Reads:   37
Position data:   36A 1T
Weight for A:   0.971181556196
Weight for T:   0.028818443804
Probability of error:   0.0407554340742 (0<->1)
Sample allele:   A
Reference (hg19) allele:   T
Known SNPs at this position:   KMS149 (T->A) Rating for known SNP
Reference sequence (100bp):   TAGTGGTGAGCGTTACAGCACTTACGTTGTTATGTCCAGAGTTTGTAACT
 T
TAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTGAC
(22270166-22270267)
Вы теперь R-KMS133, так как разделили этот снип с одним анонимным саудитом.
Другими словами под R-KMS149 образован новый подуровень R-KMS133.

Оффлайн Evg33

  • Сообщений: 404
  • Страна: ru
  • Рейтинг +27/-0
  • FTDNA: 312482
    • RusNavi
  • Y-ДНК: R-KMS132+ (Z93+,Z94-,KMS149+)
  • мтДНК: H11a1
Re: Z93*
« Ответ #239 : 19 Апрель 2016, 11:47:24 »
Semargl: О как ! Спасибо ! :)

 

© 2007 Молекулярная Генеалогия (МолГен)

Внимание! Все сообщения отражают только мнения их авторов.
Все права на материалы принадлежат их авторам (владельцам) и сетевым изданиям, с которых они взяты.


Rambler's Top100