АвторТема: Про деревья гаплогрупп  (Прочитано 11229 раз)

0 Пользователей и 1 Гость просматривают эту тему.

Оффлайн Farroukh

  • Maternal Y-DNA: R1b-L584
  • ...
  • Сообщений: 14936
  • Страна: az
  • Рейтинг +4374/-16
  • Paternal Mt-DNA: M9a1b1
    • Azerbaijan DNA Project
  • Y-ДНК: E-Y37518
  • мтДНК: F2f1
Re: Про деревья гаплогрупп
« Ответ #45 : 26 Июнь 2022, 12:11:41 »
Статья, как все, надеюсь, понимают, устарела:

Цитировать
Даже по 12 маркерам вероятность случайного совпадения – 1 шанс из двух с лишним миллиардов, и при полном совпадении чьих-нибудь DYS с вашим гаплотипом можно быть уверенным, что вы нашли брата, отца, дядю или «многоюродного» (но не более чем в десятом-пятнадцатом колене) родственника по прямой мужской линии.
У меня целых 43 случайно совпавших миллионоюродных брата. :)

Оффлайн nilogov

  • Сообщений: 1314
  • Страна: ru
  • Рейтинг +90/-3
  • философ антиязыка
  • Y-ДНК: R-BY55151
  • мтДНК: T2b-T152C!
Re: Про деревья гаплогрупп
« Ответ #46 : 26 Июнь 2022, 13:32:43 »
Статья, как все, надеюсь, понимают, устарела:

Цитировать
Даже по 12 маркерам вероятность случайного совпадения – 1 шанс из двух с лишним миллиардов, и при полном совпадении чьих-нибудь DYS с вашим гаплотипом можно быть уверенным, что вы нашли брата, отца, дядю или «многоюродного» (но не более чем в десятом-пятнадцатом колене) родственника по прямой мужской линии.
У меня целых 43 случайно совпавших миллионоюродных брата. :)

Это краткий вариант статьи, а более научно-методологический куда-то пропал...

Оффлайн nilogov

  • Сообщений: 1314
  • Страна: ru
  • Рейтинг +90/-3
  • философ антиязыка
  • Y-ДНК: R-BY55151
  • мтДНК: T2b-T152C!
Re: Про деревья гаплогрупп
« Ответ #47 : 26 Июнь 2022, 13:34:27 »
Это, видимо, первоначальный текст, а потом был расширенный вариант статьи, подготовленный для сайта Гентиса. А теперь исходник только в виде цитат у других авторов - у Склярова, например...

В архиве интернета: https://web.archive.org/web/20120510123102/http://gentis.ru/info/articles?start=5
Там ссылка на элементы, та же статья.

Да, но вот этого фрагмента там нет:

..В каком порядке происходили мутации в линии Taxon3? Ответить на данный вопрос, имея в наличии только указанный элайнмент, невозможно, например сначала могла произойти мутация в 3-ей вариабельной позиции, а затем в 4-ой, либо наоборот, сначала в 4-ой а затем в 3-ей, или наконец, обе мутации могли произойти одновременно при одной трансмиссии, хотя это и маловероятно. Однако, если бы в нашем элайнменте присутствовал такой сиквенс:

Taxon4 AGCCTGAATCGTATTAGCATGCA

то обнаружим, что он лежит "на полпути" между вариантом Taxon3 и общим предком Anc, имея только одну мутировавшую позицию - 4-ую. Таким образом, сиквенс Taxon4 - предок сиквенса Taxon3, что не мешает обоим "жить" в одно время, ведь мы сейчас рассматриваем не реальные организмы, а участки их ДНК, которые могут мутировать с разной скоростью, вследствие чего среди живых потомков Taxon4 есть как неизменные, так и мутировавшие до состояния Taxon3. Более того, среди ныне живущих организмов вполне может встретиться и носитель предкового типа Anc, хотя со временем количество таких неизмененных вариантов убывает.

Итак, мы провели простейшую филогенетическую реконструкцию - восстановили вид общего предка трех сиквенсов, при этом столкнулись с неопределенностью порядка возникновения мутаций и видели, как добавление новых данных может изменить точность нашего анализа. Изучением истории генов по ДНК занимается молекулярная филогенетика, в которой разработаны практические методы построения таких реконструкций - филогенетических деревьев, которые описывают развитие сиквенсов от древнего предка к его ныне живущим потомкам. Обсуждение методов построения деревьев выходит за рамки нашего краткого пособия, однако ниже мы рассмотрим еще несколько вопросов, относящихся к филогенетике, понимание которых принципиально даже для начинающего специалиста по молекулярной генеалогии.

Оффлайн nilogov

  • Сообщений: 1314
  • Страна: ru
  • Рейтинг +90/-3
  • философ антиязыка
  • Y-ДНК: R-BY55151
  • мтДНК: T2b-T152C!
Re: Про деревья гаплогрупп
« Ответ #48 : 26 Июнь 2022, 13:35:51 »
Это, видимо, первоначальный текст, а потом был расширенный вариант статьи, подготовленный для сайта Гентиса. А теперь исходник только в виде цитат у других авторов - у Склярова, например...

В архиве интернета: https://web.archive.org/web/20120510123102/http://gentis.ru/info/articles?start=5
Там ссылка на элементы, та же статья.

Вот товарищ Скляров какую-то другую статью что ли цитирует? https://taudok.mirtesen.ru/blog/43688243569/9--GENETICHESKIY-KOD-CHELOVECHESTVA

Оффлайн DmitroR-2

  • Сообщений: 1714
  • Страна: ru
  • Рейтинг +567/-2
Re: Про деревья гаплогрупп
« Ответ #49 : 26 Июнь 2022, 20:34:54 »
Статья, как все, надеюсь, понимают, устарела:

Цитировать
Даже по 12 маркерам вероятность случайного совпадения – 1 шанс из двух с лишним миллиардов, и при полном совпадении чьих-нибудь DYS с вашим гаплотипом можно быть уверенным, что вы нашли брата, отца, дядю или «многоюродного» (но не более чем в десятом-пятнадцатом колене) родственника по прямой мужской линии.
У меня целых 43 случайно совпавших миллионоюродных брата. :)
Ага, щас. У меня из 352 матчей на 12-ти маркерах (из них 52 точные и остальные одношаговые) 130 имеют БИГ. Из этих 130 нет ни одного матча с моей ветви возрастом в 2000 лет и самые близкие мои 12-ти маркерные матчи будут с ВБОПом от 3800 до 4100 лет.
Хотя опять же из 130 сделавших БИГ лишь четверо мои полные матчи, а все остальные-одношаговые.

 

© 2007 Молекулярная Генеалогия (МолГен)

Внимание! Все сообщения отражают только мнения их авторов.
Все права на материалы принадлежат их авторам (владельцам) и сетевым изданиям, с которых они взяты.