АвторТема: Про деревья гаплогрупп  (Прочитано 11220 раз)

0 Пользователей и 1 Гость просматривают эту тему.

Оффлайн UA6ATG

  • Сообщений: 178
  • Страна: ru
  • Рейтинг +23/-1
  • Y-ДНК: J-M172
Re: Про деревья гаплогрупп
« Ответ #30 : 20 Ноябрь 2011, 13:41:45 »
кароче - если есть снип, сворачиваешь с шоссе на дорогу, более узкую
нет снипа - едешь дальше, до своего поворота
и так несколько раз
в конце пути будешь ехать по грунтовке со своими ближними сородичами, в колхоз-ООО "40 лет без урожая"

А Вы случайно не знаете конкретного алгоритма поиска "своего колхоха"?  Мне это вопрос пока не очень ясен. 

Оффлайн Naeel

  • Сообщений: 630
  • Страна: ru
  • Рейтинг +50/-2
  • Y-ДНК: R1a1a1b2a2b* L342+ Z94+ L871+ L875+ Z2122+ L657- Z2123- F1345-
  • мтДНК: T2a 16126C 16217C 16294T 16296T 16519C 73G 263G 315.1C
Re: Про деревья гаплогрупп
« Ответ #31 : 20 Ноябрь 2011, 14:21:19 »
пока только райцентр в лучшем случае
колхоз определится, когда, например, ДНК-анализ войдёт в моду и народ ломанётся, появится выборка-статистика

искал статистику по татарам, расклад по гаплогруппам
что нашёл - выборка человек 100, да и то несколько лет назад

Оффлайн UA6ATG

  • Сообщений: 178
  • Страна: ru
  • Рейтинг +23/-1
  • Y-ДНК: J-M172
Re: Про деревья гаплогрупп
« Ответ #32 : 20 Ноябрь 2011, 14:33:00 »
пока только райцентр в лучшем случае
колхоз определится, когда, например, ДНК-анализ войдёт в моду и народ ломанётся, появится выборка-статистика

искал статистику по татарам, расклад по гаплогруппам
что нашёл - выборка человек 100, да и то несколько лет назад

Гм.... а я здесь сейчас:
http://www.pokolenia-permkray.ru/Perm.html
Отсканированный архив Пермского края
Учитывая что все мои предки по материнской линии оттуда, есть высокий шанс раскопать довольно далеко.
Понимаете, тут как то кто то жаловался, мол не успел взять ДНк у уже умершего дедушки.  А мне сдается куда важнее было спросить у дедушек и бабушек имена и фамилии их дедушек и бабушек, тогда уже есть уже реальный шанс за что то зацепится.
Лично мое мнение: этот путь пока более эффективен, если Вас интересует собственная родословная. 

Оффлайн Farroukh

  • Maternal Y-DNA: R1b-L584
  • ...
  • Сообщений: 14914
  • Страна: az
  • Рейтинг +4355/-16
  • Paternal Mt-DNA: M9a1b1
    • Azerbaijan DNA Project
  • Y-ДНК: E-Y37518
  • мтДНК: F2f1
Re: Про деревья гаплогрупп
« Ответ #33 : 21 Ноябрь 2011, 10:50:39 »
Цитировать
этот путь пока более эффективен, если Вас интересует собственная родословная
Это если фамилии дедушек/бабушек историчны.
Тем не менее, снип очень важен. Важнее, чем совпадения типа 12/12, они нередко заводят в тупик.

Оффлайн VVizard741

  • 600 years on the river Northern Dvina
  • Сообщений: 1029
  • Страна: ru
  • Рейтинг +251/-0
  • Vilegodskaya Permtsa - SolVychegodsk
    • Православные приходы и монастыри Севера
  • Y-ДНК: R1a-YP951-FGC39315 6. Vorontsov clan
  • мтДНК: H3*, мж: T1a*; ммж: U5b2a1a2
Re: Про деревья гаплогрупп
« Ответ #34 : 21 Ноябрь 2011, 16:25:46 »
Гм.... а я здесь сейчас:
http://www.pokolenia-permkray.ru/Perm.html
Отсканированный архив Пермского края
Учитывая что все мои предки по материнской линии оттуда, есть высокий шанс раскопать довольно далеко.
Понимаете, тут как то кто то жаловался, мол не успел взять ДНк у уже умершего дедушки.  А мне сдается куда важнее было спросить у дедушек и бабушек имена и фамилии их дедушек и бабушек, тогда уже есть уже реальный шанс за что то зацепится.
Лично мое мнение: этот путь пока более эффективен, если Вас интересует собственная родословная.
А если Вы всех до середины 18 века нашли (а глубже там нет) и хотите дальше знать? Сидение в РГАДА дороже ДНК теста выйдет.

Оффлайн Farroukh

  • Maternal Y-DNA: R1b-L584
  • ...
  • Сообщений: 14914
  • Страна: az
  • Рейтинг +4355/-16
  • Paternal Mt-DNA: M9a1b1
    • Azerbaijan DNA Project
  • Y-ДНК: E-Y37518
  • мтДНК: F2f1
Re: Про деревья гаплогрупп
« Ответ #35 : 24 Ноябрь 2011, 13:55:25 »
UA6ATG, небольшая ремарка.

FTDNA сначала сообщает клиенту гаплотип (маркёры), а потом чуть позже и гаплогруппу. Как только Вам будут известны Ваши маркёры - регистрируйтесь на ysearch.org, а также прогоните Ваш гаплотип через предиктор Вадима Урасина:
predictor.ydna.ru

Он на основании Ваших маркёров с высокой степенью вероятности определит Вашу гаплогруппу. Далее Вы приходите сюда и в разделе соответствующей гаплогруппы в подразделе "Я получил результаты" открываете отдельную тему, где сообщаете о Ваших результатах. Сведущие люди могут на основании этого могут сказать Вам Ваш предполагаемый субклад и ближайшее окружение (ysearch.org не всегда надёжен). Там уже будет ясно, целесообразно ли для Вас заказать уточняющий снип, и если да, то какой именно.

Оффлайн UA6ATG

  • Сообщений: 178
  • Страна: ru
  • Рейтинг +23/-1
  • Y-ДНК: J-M172
Re: Про деревья гаплогрупп
« Ответ #36 : 11 Февраль 2012, 16:49:34 »
Кстати я вот получил такое дерево на своем проекте:




L70 это понятно (я на той ветке)
Но я как начинающий не пойму что значат цифры на дереве?

Оффлайн Шад

  • Главный модератор
  • *****
  • Сообщений: 6317
  • Страна: ru
  • Рейтинг +1277/-4
  • Ex oriente lux
  • Y-ДНК: Q-Y2750
  • мтДНК: J1c2z
Re: Про деревья гаплогрупп
« Ответ #37 : 11 Февраль 2012, 18:48:18 »
Но я как начинающий не пойму что значат цифры на дереве?

Судя по всему это идентификационные номера из ФТДНА. Свой на ветви L70 видите?

Оффлайн UA6ATG

  • Сообщений: 178
  • Страна: ru
  • Рейтинг +23/-1
  • Y-ДНК: J-M172
Re: Про деревья гаплогрупп
« Ответ #38 : 11 Февраль 2012, 19:00:37 »
Но я как начинающий не пойму что значат цифры на дереве?

Судя по всему это идентификационные номера из ФТДНА. Свой на ветви L70 видите?
Да нет, не вижу.  Картинка правда от апреля 2011.  Возможно еще внесут.
Возможно надо сделать 67 маркеров.  Руководитель проекта написал  нет смысла делать снипы и так все ясно с тобой... парень.  А вот сделать 67 маркеров порекомендовал.

Оффлайн Шад

  • Главный модератор
  • *****
  • Сообщений: 6317
  • Страна: ru
  • Рейтинг +1277/-4
  • Ex oriente lux
  • Y-ДНК: Q-Y2750
  • мтДНК: J1c2z
Re: Про деревья гаплогрупп
« Ответ #39 : 11 Февраль 2012, 20:02:14 »
А вот сделать 67 маркеров порекомендовал.

Именно поэтому. Меньше 67 маркеров для деревьев не используют.

Оффлайн UA6ATG

  • Сообщений: 178
  • Страна: ru
  • Рейтинг +23/-1
  • Y-ДНК: J-M172
Re: Про деревья гаплогрупп
« Ответ #40 : 11 Февраль 2012, 20:07:42 »
А вот сделать 67 маркеров порекомендовал.

Именно поэтому. Меньше 67 маркеров для деревьев не используют.

Интересно в этом году были скидки на UPDATE 37-67? (хотя оно и сейчас стоит меньше 100$)
Напишу я руководителю письмо на эту тему, а вообще на удивление грамотный парень (по крайней мере в вопросах еврейских субкладов  ;D)

Оффлайн nilogov

  • Сообщений: 1314
  • Страна: ru
  • Рейтинг +90/-3
  • философ антиязыка
  • Y-ДНК: R-BY55151
  • мтДНК: T2b-T152C!
Re: Про деревья гаплогрупп
« Ответ #41 : 26 Июнь 2022, 09:26:22 »
Как определяется направление мутаций? Почему дерево гаплогрупп изображают направленным?
Вопрос-то вполне разумный и ответ не лежит на поверхности. Но кое-что на сайте gentis объясняется. Например:
Цитировать
..В каком порядке происходили мутации в линии Taxon3? Ответить на данный вопрос, имея в наличии только указанный элайнмент, невозможно, например сначала могла произойти мутация в 3-ей вариабельной позиции, а затем в 4-ой, либо наоборот, сначала в 4-ой а затем в 3-ей, или наконец, обе мутации могли произойти одновременно при одной трансмиссии, хотя это и маловероятно. Однако, если бы в нашем элайнменте присутствовал такой сиквенс:

Taxon4 AGCCTGAATCGTATTAGCATGCA

то обнаружим, что он лежит "на полпути" между вариантом Taxon3 и общим предком Anc, имея только одну мутировавшую позицию - 4-ую. Таким образом, сиквенс Taxon4 - предок сиквенса Taxon3, что не мешает обоим "жить" в одно время, ведь мы сейчас рассматриваем не реальные организмы, а участки их ДНК, которые могут мутировать с разной скоростью, вследствие чего среди живых потомков Taxon4 есть как неизменные, так и мутировавшие до состояния Taxon3. Более того, среди ныне живущих организмов вполне может встретиться и носитель предкового типа Anc, хотя со временем количество таких неизмененных вариантов убывает.

Итак, мы провели простейшую филогенетическую реконструкцию - восстановили вид общего предка трех сиквенсов, при этом столкнулись с неопределенностью порядка возникновения мутаций и видели, как добавление новых данных может изменить точность нашего анализа. Изучением истории генов по ДНК занимается молекулярная филогенетика, в которой разработаны практические методы построения таких реконструкций - филогенетических деревьев, которые описывают развитие сиквенсов от древнего предка к его ныне живущим потомкам. Обсуждение методов построения деревьев выходит за рамки нашего краткого пособия, однако ниже мы рассмотрим еще несколько вопросов, относящихся к филогенетике, понимание которых принципиально даже для начинающего специалиста по молекулярной генеалогии.
А Вы, уважаемый katon, отмахнулись от этой ссылки и никак ее не прокомментировали  :(
Как расстояние между гаплогруппами переводится в конкретное время расхождения? Объясните пожалуйста методику на пальцах. И как оценивать надежность/ошибку подобных датировок?
На примере митохондриальных датировок. Сравнивая африканские и не-африканские  митохондриальные хромосомы, выделяют набор мутаций, который произошел вне Африки. Конечно, в каждой прямой женской линии свой набор и свое количество мутаций, но можно посчитать среднее и доверительный интервал этой средней величины. Далее, по археологическим находкам мы знаем, что успешный выход наших предков из Африки произошел примерно 70 тысяч лет назад, делим его на среднее число не-африканских мутаций и получаем число лет на мутацию. Если  70 тысяч лет будет пересмотрено археологами, то и скорость мутаций пропорционально будет пересмотрена. Теперь мы имеем примерное время ветвления митохондриального дерева. Естественно, мутации происходили не с равными интервалами времени, а как любое случайное событие (вспышка новой звезды, падение метеорита...), поэтому и датировка узлов дерева весьма приблизительна.

Подскажите, а есть ли исходный текст Чубенко «Сыновья Адама», который ранее, видимо, был размещен на сайте Гентиса?

Оффлайн NathanS

  • Сообщений: 815
  • Страна: 00
  • Рейтинг +617/-2
Re: Про деревья гаплогрупп
« Ответ #42 : 26 Июнь 2022, 10:18:19 »
Подскажите, а есть ли исходный текст Чубенко «Сыновья Адама», который ранее, видимо, был размещен на сайте Гентиса?

Гуглится два варианта этой статьи: https://vechnayamolodost.ru/articles/genetika/sinovya_adama_geni_istoriya_i_geografiya/
и https://elementy.ru/nauchno-populyarnaya_biblioteka/430522/Synovya_Adama

Оффлайн nilogov

  • Сообщений: 1314
  • Страна: ru
  • Рейтинг +90/-3
  • философ антиязыка
  • Y-ДНК: R-BY55151
  • мтДНК: T2b-T152C!
Re: Про деревья гаплогрупп
« Ответ #43 : 26 Июнь 2022, 11:58:34 »
Подскажите, а есть ли исходный текст Чубенко «Сыновья Адама», который ранее, видимо, был размещен на сайте Гентиса?

Гуглится два варианта этой статьи: https://vechnayamolodost.ru/articles/genetika/sinovya_adama_geni_istoriya_i_geografiya/
и https://elementy.ru/nauchno-populyarnaya_biblioteka/430522/Synovya_Adama

Это, видимо, первоначальный текст, а потом был расширенный вариант статьи, подготовленный для сайта Гентиса. А теперь исходник только в виде цитат у других авторов - у Склярова, например...

Оффлайн NathanS

  • Сообщений: 815
  • Страна: 00
  • Рейтинг +617/-2
Re: Про деревья гаплогрупп
« Ответ #44 : 26 Июнь 2022, 12:07:39 »
Это, видимо, первоначальный текст, а потом был расширенный вариант статьи, подготовленный для сайта Гентиса. А теперь исходник только в виде цитат у других авторов - у Склярова, например...

В архиве интернета: https://web.archive.org/web/20120510123102/http://gentis.ru/info/articles?start=5
Там ссылка на элементы, та же статья.

 

© 2007 Молекулярная Генеалогия (МолГен)

Внимание! Все сообщения отражают только мнения их авторов.
Все права на материалы принадлежат их авторам (владельцам) и сетевым изданиям, с которых они взяты.