АвторТема: Компания Dante Labs  (Прочитано 86078 раз)

0 Пользователей и 1 Гость просматривают эту тему.

Оффлайн Semargl

  • "El sueño de la razón produce monstruos" ©
  • Модератор
  • *****
  • Сообщений: 5492
  • Страна: hr
  • Рейтинг +2963/-5
  • www.semargl.me
    • www.semargl.me
  • Y-ДНК: R1a [CTS3402+]
  • мтДНК: U4a2g
Re: Компания Dante Labs
« Ответ #1350 : 24 Ноябрь 2020, 09:35:55 »
Подкупает только цена, но тут реально рулетка...

Подумываю сейчас заказать пару китов от Небулы, тем более образцы должны быть ценные.

Если сравнивать результаты от Данте и Небулы, у кого лучше покрытие и прочее?
В среднем сопоставимое. Может Небула чуть лучше. Хотя по отзывам в FB у DL сейчас покрытие стало ниже заявленного. Но сам не видел.

Оффлайн Semargl

  • "El sueño de la razón produce monstruos" ©
  • Модератор
  • *****
  • Сообщений: 5492
  • Страна: hr
  • Рейтинг +2963/-5
  • www.semargl.me
    • www.semargl.me
  • Y-ДНК: R1a [CTS3402+]
  • мтДНК: U4a2g
Re: Компания Dante Labs
« Ответ #1351 : 24 Ноябрь 2020, 09:39:22 »
А как сейчас обстоят дела с доставкой контейнеров со средой в Россию. Год назад они доставляли в DHL и видимо из-за того, что писали ДНК на упаковки их разворачивали.

Есть ли до кого доходили посылки из ДантеЛабс в последний год? Через что через Почту России или DHL?

Можно ли в России купить совместимые с ДантеЛабс контейнеры со средой? И как обойти уникальный номер kit?
Проблема как была, так и осталась. DHL доставляет в Россию только юрлицам. Поэтому если у вас нет юрлица, то заказ следует оформлять через посредников. Например https://www.shipito.com/
Это где-то еще +20$.

Оффлайн AlexVN

  • Сообщений: 7
  • Страна: ru
  • Рейтинг +3/-0
Re: Компания Dante Labs
« Ответ #1352 : 24 Ноябрь 2020, 12:51:42 »
Всем привет, за год переписки с дантелабс мне так и не удалось получить от них обработанных данных(VCF и пр)
Поэтому придется обрабатывать самому.
Подскажите не появилось ли проверенных пайплайнов для обработки Long Reads от DanteLabs?
А наличии у меня от них только FASTQ размером в 200гб

Оффлайн Semargl

  • "El sueño de la razón produce monstruos" ©
  • Модератор
  • *****
  • Сообщений: 5492
  • Страна: hr
  • Рейтинг +2963/-5
  • www.semargl.me
    • www.semargl.me
  • Y-ДНК: R1a [CTS3402+]
  • мтДНК: U4a2g
Re: Компания Dante Labs
« Ответ #1353 : 24 Ноябрь 2020, 13:15:46 »
Всем привет, за год переписки с дантелабс мне так и не удалось получить от них обработанных данных(VCF и пр)
Поэтому придется обрабатывать самому.
Подскажите не появилось ли проверенных пайплайнов для обработки Long Reads от DanteLabs?
А наличии у меня от них только FASTQ размером в 200гб
Советую обратиться в YSEQ. Томас вроде бы делал свой алгоритм для маппирования LR.
BWA точно не подойдет. Лучше наверное использовать https://github.com/lh3/minimap2

Оффлайн AlexVN

  • Сообщений: 7
  • Страна: ru
  • Рейтинг +3/-0
Re: Компания Dante Labs
« Ответ #1354 : 24 Ноябрь 2020, 13:34:30 »
Всем привет, за год переписки с дантелабс мне так и не удалось получить от них обработанных данных(VCF и пр)
Поэтому придется обрабатывать самому.
Подскажите не появилось ли проверенных пайплайнов для обработки Long Reads от DanteLabs?
А наличии у меня от них только FASTQ размером в 200гб
Советую обратиться в YSEQ. Томас вроде бы делал свой алгоритм для маппирования LR.
BWA точно не подойдет. Лучше наверное использовать https://github.com/lh3/minimap2
Спасибо YSEQ посмотрю.
С помощью minimap2 удалось выровнять на hg38, вот только не могу понять качество, может есть какие-то метрики для оценки качества выравнивания да и сервенирования в целом?
А вот на следующем этапе BAM => VCF я пока завис, изучаю samtools/bcftools и в планах GATK, но встанет тот же вопрос, как оценить качество полученных результатов?

Оффлайн Val_Metov

  • Сообщений: 197
  • Страна: ru
  • Рейтинг +87/-1
  • Y-ДНК: J-Y94477
Re: Компания Dante Labs
« Ответ #1355 : 24 Ноябрь 2020, 14:08:42 »
Всем привет, за год переписки с дантелабс мне так и не удалось получить от них обработанных данных(VCF и пр)
Поэтому придется обрабатывать самому.
Подскажите не появилось ли проверенных пайплайнов для обработки Long Reads от DanteLabs?
А наличии у меня от них только FASTQ размером в 200гб
Советую обратиться в YSEQ. Томас вроде бы делал свой алгоритм для маппирования LR.
BWA точно не подойдет. Лучше наверное использовать https://github.com/lh3/minimap2
Спасибо YSEQ посмотрю.
С помощью minimap2 удалось выровнять на hg38, вот только не могу понять качество, может есть какие-то метрики для оценки качества выравнивания да и сервенирования в целом?
А вот на следующем этапе BAM => VCF я пока завис, изучаю samtools/bcftools и в планах GATK, но встанет тот же вопрос, как оценить качество полученных результатов?
А что говорит WGS extract? Статистика т.е.
VCF у меня тоже вызывает вопросы. Пробовал разными способами, например как в статье
https://towardsdatascience.com/machine-learning-in-bioinformatics-genome-geography-d1b1dbbfb4c2?gi=257e8da4bd3

Но я делаю на вырезанную Y хромасому. На весь геном много времени занимает.

Оффлайн Alexey_V.B.

  • Сообщений: 840
  • Страна: il
  • Рейтинг +207/-0
  • Y-ДНК: R1a (R-A8995*)
  • мтДНК: K1a1b1a
Re: Компания Dante Labs
« Ответ #1356 : 24 Ноябрь 2020, 14:46:29 »
Все верно, однако я как и многие в раздумьях. С одной стороны долгое ожидание, даже если и год не смертельно. Когда мы копаем в глубь сотен и тысяч лет, даже десятки месяцев это не смертельно. Терпение хорошее разовьется. С другой стороны не факт, что они когда нибудь вообще сделают. Пожалуй стоит подождать как минимум до пятницы. Может Nebula скинет сотню баксов. Очень в этом сомневаюсь, но ждать не долго.

Год назад начитался ужасов, но всё же (с максимальными скидками) заказал три теста себе и в семью - всё прошло на удивление удачно. Затянули только анализ на неделю сразу после Нового года и выдачцу отчетов, но письма в суппорт быстро ускорили процессы.
Сейчас заказываю мед. отчеты (All Panels Package) со скидкой по цене $99 вместо $500.

Онлайн Valery

  • Сообщений: 5624
  • Страна: 00
  • Рейтинг +525/-6
  • Ultimate Matriarchy
Re: Компания Dante Labs
« Ответ #1357 : 24 Ноябрь 2020, 15:07:11 »
например как в статье
https://towardsdatascience.com/machine-learning-in-bioinformatics-genome-geography-d1b1dbbfb4c2?gi=257e8da4bd3

Но я делаю на вырезанную Y хромасому. На весь геном много времени занимает.

коллеры нуждаются в параметре ploidy, и freebayes не исключение. Поэтому "как в статье" для У не подойдет.

Оффлайн NathanS

  • Сообщений: 371
  • Рейтинг +249/-2
Re: Компания Dante Labs
« Ответ #1358 : 24 Ноябрь 2020, 23:03:20 »
Чем платить 100$ за Bam файл в ФТДНА, лучше купить этот тест и крутануть итальянскую рулетку 8)

К сожaлeнию рулетка. После нового года отправил образцы, получил результаты во время. Но у одного образца вот такой анализ качества. По fastp забраковано 30% ридов. Уровень дубликации 11.5%.

А вот несколько картинок после обработки FastQC.
Read_1:






Read_2:







Overrepresented sequences
Sequence   Count   Percentage   Possible Source
GTGGAATTCAGTTAGACGATTTTGAATGTGTTTCCTGAATGCTGACCGTG   3232093   6.588783855987028   No Hit
NACCAGCTCCTGCCAGGGAAACCGGTTCCATCCAGAGCCTGGCTTGTGTC   3207111   6.537856794701889   No Hit
GTGCCCGAGCCGTCGCCCATTCTGGAATCCTATGTGGTGGGCATGGCCGT   3188685   6.500294468577482   No Hit
CTCCTCATCAATTTCTTTGCTTCTTCATCCATCCACTCATCTGTCCTTCA   3187571   6.498023523646265   No Hit
GGTGCACCCCGCTGCACCACCTCAGGGGGAGTCCTTTTATATATGGGGGT   3179734   6.482047405669657   No Hit
GTACAGCTCCACCTTGGCCTGCACTGTCCAGCCTGCCGAGCCGAAGCCCC   3162630   6.447180042919635   No Hit
NCTCTCACGTGCTTGATCTGTTCTGTCTGTGTCCTTTAATATAAATGTTT   3130393   6.3814632998786855   No Hit
GTTTGGGTCTACCTGGTAAGATTAGAATACAGAGGAGTCTGAGGCTATGA   3098774   6.317006380866004   No Hit
GTTTCTTGGGGAACCACTGCATTTAAATTCGAGTTCAAATTAAATAAAAC   3079839   6.278406432685951   No Hit
GCGGGGGCGGGGGGGCGCTCCGACGGCCGGGATGATAATTACAGTTTGCG   3069964   6.258275749386345   No Hit
GACATTGCTTCTATCTAGTTTTTATTGGAAGATATCTCCTTTTTCACCGT   3063495   6.245088368093672   No Hit
GTATGTACCAGGAGCCAATGAGATGTGCATGTCAGCTGTAGCTGCCTTTG   3046256   6.209945801065632   No Hit
NGTCTACGTACTCGCCGGTCTTGGCGTTGAATCCGTGACCCACGGGCAGT   2991804   6.098942665163847   No Hit
GGAGTAAATGCGCAACAACGTGCGGTAGCCATCCACCATTTGGACACGCC   2890252   5.891923814486224   No Hit
ATTGTACATTATCCATTGTATGTGCATGGCTTCACCCCTAACCACCTTTT   2874613   5.860042927790271   No Hit
GTGCTGGACCATAGTTTTTTCCATTCATGGTTATCACGCAGGCGCTTGTC   2651256   5.404718469081411   No Hit

Пока все хорошо, то хорошо. Но на мои е-мэйлы Данте не отвечает. Посылал им все отчеты по качеству, но реакции ноль. Сделали 96 Гигабаз, но то, что 30% полное ..., их не волнует. Поэтому рулетка. Если все хорошо, то будьте довольны результатами, но сами проверяйте качество полученных данных fastp, fastqc и bamqc. Иначе то, что написано в отчетах по здоровью, будет просто ненадежно.

Оффлайн AlexVN

  • Сообщений: 7
  • Страна: ru
  • Рейтинг +3/-0
Re: Компания Dante Labs
« Ответ #1359 : 24 Ноябрь 2020, 23:08:35 »
Всем привет, за год переписки с дантелабс мне так и не удалось получить от них обработанных данных(VCF и пр)
Поэтому придется обрабатывать самому.
Подскажите не появилось ли проверенных пайплайнов для обработки Long Reads от DanteLabs?
А наличии у меня от них только FASTQ размером в 200гб
Советую обратиться в YSEQ. Томас вроде бы делал свой алгоритм для маппирования LR.
BWA точно не подойдет. Лучше наверное использовать https://github.com/lh3/minimap2
Спасибо YSEQ посмотрю.
С помощью minimap2 удалось выровнять на hg38, вот только не могу понять качество, может есть какие-то метрики для оценки качества выравнивания да и сервенирования в целом?
А вот на следующем этапе BAM => VCF я пока завис, изучаю samtools/bcftools и в планах GATK, но встанет тот же вопрос, как оценить качество полученных результатов?
А что говорит WGS extract? Статистика т.е.
VCF у меня тоже вызывает вопросы. Пробовал разными способами, например как в статье
https://towardsdatascience.com/machine-learning-in-bioinformatics-genome-geography-d1b1dbbfb4c2?gi=257e8da4bd3

Но я делаю на вырезанную Y хромасому. На весь геном много времени занимает.

WGS extract показывает так https://ibb.co/gS7y3TL , это по результатам minimap2
вот только я не понимаю хороший это результат или нет )

сейчас еще пробую выравнять при помощи ngmlr - посмотрю насколько будет отличаться результат

Оффлайн Alexey_V.B.

  • Сообщений: 840
  • Страна: il
  • Рейтинг +207/-0
  • Y-ДНК: R1a (R-A8995*)
  • мтДНК: K1a1b1a
Re: Компания Dante Labs
« Ответ #1360 : 25 Ноябрь 2020, 00:56:12 »
Выравнивание в YSeq стОит $25 https://www.yseq.net/product_info.php?products_id=107732&osCsid=33baebcc867083a1cee4e848e13bf222
сейчас цена в Данте Лабс на WGS х30 $149 (с использованием VPN и выбором США).

Онлайн Valery

  • Сообщений: 5624
  • Страна: 00
  • Рейтинг +525/-6
  • Ultimate Matriarchy
Re: Компания Dante Labs
« Ответ #1361 : 25 Ноябрь 2020, 02:03:53 »

Overrepresented sequences
Sequence   Count   Percentage   Possible Source
GTGGAATTCAGTTAGACGATTTTGAATGTGTTTCCTGAATGCTGACCGTG   3232093   6.588783855987028   No Hit
...

fastqc точно не знаком с адаптерами этой платформы, иначе бы так и написал в отчете, что это адаптеры. Копайте на тему что это и тримьте, так собирать нельзя. Проще всего попросить файл адаптеров в самой же лабе.

Оффлайн ochkas

  • Сообщений: 413
  • Страна: ru
  • Рейтинг +169/-0
  • FTDNA: 634321
    • Ochkas DNA
  • Y-ДНК: R1a-L1029-Y128293 (UKR)
  • мтДНК: U3a3a1 (BLR)
Re: Компания Dante Labs
« Ответ #1362 : 26 Ноябрь 2020, 17:27:55 »
В Россию тесты DanteLabs нормально доставить не могут.
В Украину доставляют знаю без проблем.
А как обстоят дела с Беларусью и Казахстаном? Кто знает?

Оффлайн Пашкевич Павел

  • Сообщений: 203
  • Страна: by
  • Рейтинг +127/-0
  • Y-ДНК: I1 -Y7477
  • мтДНК: H1b2
Re: Компания Dante Labs
« Ответ #1363 : 26 Ноябрь 2020, 22:55:51 »
В Россию тесты DanteLabs нормально доставить не могут.
В Украину доставляют знаю без проблем.
А как обстоят дела с Беларусью и Казахстаном? Кто знает?
по РБ:
два года назад брал набор для родича (спецом для игрека).
было прислано два - т.к. в саппорте спецом просил именно с щеточками, но в итоге получил два варианта набора:
геморрой с получением первого и растаможкой - либо сам гонишь в аэропорт(который за 25 км  от города) и весь день убиваешь на это либо плати конторе 20баксов и получи в руки на дом...
второй просто по обычной почте пришел через недельку(был очень удивлен, но и ладно) - пришлось просить гос.оценщика оценить, чтобы пошлину не выплачивать.
на этом мытарства с получением были закончены, учтя, что законы в этой сфере  не менялись - коллегам приходится проходить их снова и снова.

тест сделал в апреле человеку, сразу же отправлен и на 1ое июня он уже был давно получен лабой. Но так как лаба ковидные тесты делала, решил не торопить их.
в сентябре написал в саппорт - т.к. никакой подвижки не было, а первая волна уже прошла, кстати ответили быстро.
мне написали, мол "лаба загружена извините, ваш набор в целости и сохранности"
Однако, уже вот декабрь на носу, а подвижек нет.
я уже боюсь загадывать какое будет качество прочтения, чтобы yfull еще принял.
p.s. фтдна - всё ж таки удобнее/проще/быстрее для меня.

Оффлайн Val_Metov

  • Сообщений: 197
  • Страна: ru
  • Рейтинг +87/-1
  • Y-ДНК: J-Y94477
Re: Компания Dante Labs
« Ответ #1364 : 27 Ноябрь 2020, 08:08:40 »
Я думаю выбор основной в плоскости Dante или Nebula. Второй во всем лучше кроме текущей цены. Мой опыт охоты за халявой почти всегда отрицательный. Была надежда на скидки в черную пятницу от Nebula, но их не будет. Только на подписку. Сейчас ее можно взять за 150$ lifetime. Но как по мне, это лишняя трата денег. Разве что геномным браузером иногда удобно пользоваться.

 

© 2007 Молекулярная Генеалогия (МолГен)

Внимание! Все сообщения отражают только мнения их авторов.
Все права на материалы принадлежат их авторам (владельцам) и сетевым изданиям, с которых они взяты.


Rambler's Top100