АвторТема: Компания Dante Labs  (Прочитано 85632 раз)

0 Пользователей и 1 Гость просматривают эту тему.

Оффлайн Alexey_V.B.

  • Сообщений: 839
  • Страна: il
  • Рейтинг +207/-0
  • Y-ДНК: R1a (R-A8995*)
  • мтДНК: K1a1b1a
Re: Компания Dante Labs
« Ответ #1365 : 25 Ноябрь 2020, 00:56:12 »
Выравнивание в YSeq стОит $25 https://www.yseq.net/product_info.php?products_id=107732&osCsid=33baebcc867083a1cee4e848e13bf222
сейчас цена в Данте Лабс на WGS х30 $149 (с использованием VPN и выбором США).

Онлайн Valery

  • Сообщений: 5574
  • Страна: 00
  • Рейтинг +519/-6
  • Ultimate Matriarchy
Re: Компания Dante Labs
« Ответ #1366 : 25 Ноябрь 2020, 02:03:53 »

Overrepresented sequences
Sequence   Count   Percentage   Possible Source
GTGGAATTCAGTTAGACGATTTTGAATGTGTTTCCTGAATGCTGACCGTG   3232093   6.588783855987028   No Hit
...

fastqc точно не знаком с адаптерами этой платформы, иначе бы так и написал в отчете, что это адаптеры. Копайте на тему что это и тримьте, так собирать нельзя. Проще всего попросить файл адаптеров в самой же лабе.

Оффлайн ochkas

  • Сообщений: 413
  • Страна: ru
  • Рейтинг +169/-0
  • FTDNA: 634321
    • Ochkas DNA
  • Y-ДНК: R1a-L1029-Y128293 (UKR)
  • мтДНК: U3a3a1 (BLR)
Re: Компания Dante Labs
« Ответ #1367 : 26 Ноябрь 2020, 17:27:55 »
В Россию тесты DanteLabs нормально доставить не могут.
В Украину доставляют знаю без проблем.
А как обстоят дела с Беларусью и Казахстаном? Кто знает?

Оффлайн Пашкевич Павел

  • Сообщений: 199
  • Страна: by
  • Рейтинг +125/-0
  • Y-ДНК: I1 -Y7477
  • мтДНК: H1b2
Re: Компания Dante Labs
« Ответ #1368 : 26 Ноябрь 2020, 22:55:51 »
В Россию тесты DanteLabs нормально доставить не могут.
В Украину доставляют знаю без проблем.
А как обстоят дела с Беларусью и Казахстаном? Кто знает?
по РБ:
два года назад брал набор для родича (спецом для игрека).
было прислано два - т.к. в саппорте спецом просил именно с щеточками, но в итоге получил два варианта набора:
геморрой с получением первого и растаможкой - либо сам гонишь в аэропорт(который за 25 км  от города) и весь день убиваешь на это либо плати конторе 20баксов и получи в руки на дом...
второй просто по обычной почте пришел через недельку(был очень удивлен, но и ладно) - пришлось просить гос.оценщика оценить, чтобы пошлину не выплачивать.
на этом мытарства с получением были закончены, учтя, что законы в этой сфере  не менялись - коллегам приходится проходить их снова и снова.

тест сделал в апреле человеку, сразу же отправлен и на 1ое июня он уже был давно получен лабой. Но так как лаба ковидные тесты делала, решил не торопить их.
в сентябре написал в саппорт - т.к. никакой подвижки не было, а первая волна уже прошла, кстати ответили быстро.
мне написали, мол "лаба загружена извините, ваш набор в целости и сохранности"
Однако, уже вот декабрь на носу, а подвижек нет.
я уже боюсь загадывать какое будет качество прочтения, чтобы yfull еще принял.
p.s. фтдна - всё ж таки удобнее/проще/быстрее для меня.

Оффлайн Val_Metov

  • Сообщений: 190
  • Страна: ru
  • Рейтинг +84/-1
  • Y-ДНК: J-Y94477
Re: Компания Dante Labs
« Ответ #1369 : 27 Ноябрь 2020, 08:08:40 »
Я думаю выбор основной в плоскости Dante или Nebula. Второй во всем лучше кроме текущей цены. Мой опыт охоты за халявой почти всегда отрицательный. Была надежда на скидки в черную пятницу от Nebula, но их не будет. Только на подписку. Сейчас ее можно взять за 150$ lifetime. Но как по мне, это лишняя трата денег. Разве что геномным браузером иногда удобно пользоваться.

Оффлайн Arthwr

  • Сообщений: 1211
  • Страна: ua
  • Рейтинг +688/-6
    • r1b-pf7562.blogspot.com
  • Y-ДНК: R1b-PF7563
  • мтДНК: K1c1e
Re: Компания Dante Labs
« Ответ #1370 : 27 Ноябрь 2020, 11:14:45 »
Я думаю выбор основной в плоскости Dante или Nebula. Второй во всем лучше кроме текущей цены.

 :)

Это почему же во всём лучше?

Вот отчёты по Небула:

http://forum.molgen.org/index.php/topic,12567.msg503512.html#msg503512

http://forum.molgen.org/index.php/topic,12567.msg505824.html#msg505824

http://forum.molgen.org/index.php/topic,12567.msg505273.html#msg505273

А вот мои, дантовские, как говорится, сличайте: ))

https://www.yfull.com/share/yreport/9467d25e2ab5ac5fba035d35028b2428/

http://forum.molgen.org/index.php/topic,10204.msg483030.html#msg483030

http://forum.molgen.org/index.php/topic,10204.msg481039.html#msg481039

Оффлайн Val_Metov

  • Сообщений: 190
  • Страна: ru
  • Рейтинг +84/-1
  • Y-ДНК: J-Y94477
Re: Компания Dante Labs
« Ответ #1371 : 27 Ноябрь 2020, 12:38:15 »
Частные случаи бывают разные. В целом качество Nebula стабильное. Я не заморачивался (по не знанию), процедура забора была, скажем прямо, не очень качественно организована.
У Данте результаты плавают. Есть катастрофические, есть очень приличные. У людей есть ошибочное свойство ориентироваться только на свой опыт. Это ошибка. У Данте есть ряд серьезных проблем:
1. Сроки. Катастрофа. Очень много жалоб. Facebook полон людей который их сильно ругают.
2. Плавающее качество.
3. Очень плохая поддержка. Работают по методу страусов.
4. Не выдают обещанные файлы (возможно проблема решена, но многих она коснулась.)

Стоит ли эти риски такого выигрыша в цене?

Я для себя смоделировал развитие событий:
1. Тест не сделают совсем. Вариант а) деньги вернут, скорее всего не скоро. Вариант б) не вернут.
2. Тест сделают, но с плохим качеством. а) Ничего не поменяют. б) нет варианта б. Ничего они не переделают. Пока нет прецедентов.
3. Тест сделают с хорошим качеством. а) долго. б) быстро.

Хотелось бы 3 б), но склоняюсь к тому, что это наименее вероятный сценарий. Но на самом деле и и 3 а) устроило бы. Но, опять но.

Оффлайн Arthwr

  • Сообщений: 1211
  • Страна: ua
  • Рейтинг +688/-6
    • r1b-pf7562.blogspot.com
  • Y-ДНК: R1b-PF7563
  • мтДНК: K1c1e
Re: Компания Dante Labs
« Ответ #1372 : 27 Ноябрь 2020, 13:42:23 »
Я не заморачивался (по не знанию), процедура забора была, скажем прямо, не очень качественно организована.

Что ж Вы так, не заморочились-то :)

Надо было заморочиться, как я, например: открыл кран, набрал в жменю проточной воды и прополоскал рот, всё :)

Просто надо блюсти гигиену полости рта не только перед забором образца, а по жизни :-X

Оффлайн Saken

  • Сообщений: 269
  • Страна: kz
  • Рейтинг +122/-0
  • YFull: YF79031
  • Y-ДНК: C3d [C-Z33001], R1a [R-ZQ651], C3x*
  • мтДНК: D4g1* & F1b
Re: Компания Dante Labs
« Ответ #1373 : 27 Ноябрь 2020, 17:35:48 »
Я думаю выбор основной в плоскости Dante или Nebula. Второй во всем лучше кроме текущей цены.

 :)

Это почему же во всём лучше?

Вот отчёты по Небула:

http://forum.molgen.org/index.php/topic,12567.msg503512.html#msg503512

http://forum.molgen.org/index.php/topic,12567.msg505824.html#msg505824

http://forum.molgen.org/index.php/topic,12567.msg505273.html#msg505273

А вот мои, дантовские, как говорится, сличайте: ))

https://www.yfull.com/share/yreport/9467d25e2ab5ac5fba035d35028b2428/

http://forum.molgen.org/index.php/topic,10204.msg483030.html#msg483030

http://forum.molgen.org/index.php/topic,10204.msg481039.html#msg481039

Раз сравнение шло с моими результатами от Небулы, вставлю свои 5 копеек:-)

Вам крупно повезло с Данте, таких результатов как ваши меньшинство чем большинство! ::) У некоторых Небуловцев 125-130Гигабайзев вышло в объеме, но они тоже больше исключение из правил.

Оффлайн Saken

  • Сообщений: 269
  • Страна: kz
  • Рейтинг +122/-0
  • YFull: YF79031
  • Y-ДНК: C3d [C-Z33001], R1a [R-ZQ651], C3x*
  • мтДНК: D4g1* & F1b
Re: Компания Dante Labs
« Ответ #1374 : 27 Ноябрь 2020, 17:44:13 »
Я думаю выбор основной в плоскости Dante или Nebula. Второй во всем лучше кроме текущей цены.

Согласен, цена у Небулы в этот Black Friday вышла как в обычные дни :D
Хотя надо отдасть должное Nebula, в обычные дни у Данте тест WGS 30x стоит свыше 600$, что в 2 раза дороже чем у Небулы. Но цена на черную пятницу в Данте действительно очень вкусная.

Оффлайн Alexey_V.B.

  • Сообщений: 839
  • Страна: il
  • Рейтинг +207/-0
  • Y-ДНК: R1a (R-A8995*)
  • мтДНК: K1a1b1a
Re: Компания Dante Labs
« Ответ #1375 : 27 Ноябрь 2020, 18:59:15 »
Всё же на нескольких тестах разница в цене весьма ощутима, так что склоняюсь повторить опыт 2019 года.
Да и прошло у меня всё с Данте Лабс удачно.

Оффлайн NathanS

  • Сообщений: 360
  • Рейтинг +242/-2
Re: Компания Dante Labs
« Ответ #1376 : 30 Ноябрь 2020, 21:06:47 »
... У Данте есть ряд серьезных проблем:

Стоит ли эти риски такого выигрыша в цене?

Я для себя смоделировал развитие событий:
1. Тест не сделают совсем. Вариант а) деньги вернут, скорее всего не скоро. Вариант б) не вернут.
2. Тест сделают, но с плохим качеством. а) Ничего не поменяют. б) нет варианта б. Ничего они не переделают. Пока нет прецедентов.
3. Тест сделают с хорошим качеством. а) долго. б) быстро.

Хотелось бы 3 б), но склоняюсь к тому, что это наименее вероятный сценарий. Но на самом деле и и 3 а) устроило бы. Но, опять но.

Кажется есть вариант 2 в) ни за что не сознаются, но переделают.

Я им писал мэйлы с моим анализом BAMа и FASTQ, но без ответа, отписался на Facebookе пару раз. Первое - анализ качества при помощи программы fastp - линии дложны быть более или менее гладкие, без резких скачков, маппирование 90-95%, ближе к 95%, длина ближе к заявленной 150bp. BAMqc выдает тоже хорошую статистику по их BAM-файлу. Уровень дупликации должен быть низким, немаппированные и отброшенные последовательности тоже должны быть на низком уровне. FastQC тоже хорошая программа для анализа - в мануале к ней есть примеры возможны ошибок и их причин. Возможно потребуется разделение данных по секвенатору и "линии" (не знаю как это правильно называется). На вероятные технические ошибки я и давил.

Написали, что произошла ошибка при загрузке данных и новые данные будут скоро загружены. Сомнительно, но надо проанализировать что они загрузят. Разборки заняли 10 месяцев.

Онлайн Valery

  • Сообщений: 5574
  • Страна: 00
  • Рейтинг +519/-6
  • Ultimate Matriarchy
Re: Компания Dante Labs
« Ответ #1377 : 30 Ноябрь 2020, 21:40:09 »
Возможно потребуется разделение данных по секвенатору и "линии" (не знаю как это правильно называется).

lane - дорожка, они в некотором смысле независимы

Оффлайн mladshij

  • Сообщений: 792
  • Страна: ru
  • Рейтинг +111/-0
  • Darth Vader
  • Y-ДНК: R1a-Z92 -> YP569 -> Y85137
  • мтДНК: H1
Re: Компания Dante Labs
« Ответ #1378 : 01 Декабрь 2020, 08:00:55 »
Кажется есть вариант 2 в) ни за что не сознаются, но переделают.

Вот в это не верится. В результатах одного из тестов замапировалось только 27% ридов. Длительная переписка привела к тому, что они в итоге сказали, что раз они прочитали 91 гигабазы, то на этом их обязательства исполнены. А то, что из 91 гигабаз мапируется только 27%, так это мои личные проблемы и они ничего делать не будут. После чего просто перестали отвечать на письма.

Оффлайн Alexey_V.B.

  • Сообщений: 839
  • Страна: il
  • Рейтинг +207/-0
  • Y-ДНК: R1a (R-A8995*)
  • мтДНК: K1a1b1a
Re: Компания Dante Labs
« Ответ #1379 : 02 Декабрь 2020, 12:19:11 »
В результатах одного из тестов замапировалось только 27% ридов. Длительная переписка привела к тому, что они в итоге сказали, что раз они прочитали 91 гигабазы, то на этом их обязательства исполнены. А то, что из 91 гигабаз мапируется только 27%, так это мои личные проблемы и они ничего делать не будут. После чего просто перестали отвечать на письма.
в декабре 2019 - январе 2020 у меня всё удачно получилось с Dante Labs и я всё ж рискнул и три дня назад заказал через VPN (США) 4 набора по $149 для родственников в России. адрес доставки указал Shipito - ранее использовал для получения наборов с Ancestry.com
а Вы давно заказывали набор и сдали метериал в Dante Labs?

 

© 2007 Молекулярная Генеалогия (МолГен)

Внимание! Все сообщения отражают только мнения их авторов.
Все права на материалы принадлежат их авторам (владельцам) и сетевым изданиям, с которых они взяты.


Rambler's Top100