АвторТема: Про деревья гаплогрупп  (Прочитано 8962 раз)

0 Пользователей и 1 Гость просматривают эту тему.

Оффлайн katonАвтор темы

  • Сообщений: 2
  • Рейтинг +1/-0
Про деревья гаплогрупп
« : 17 Май 2011, 13:26:14 »
Уважаемые господа, объясните пожалуйста простым языком (совсем для чайников) несколько вопросов про гаплогруппы (прежде всего подразумеваются y и мт):

Насколько я представляю, дерево гаплогрупп отражает близость между существующими гаплогруппами и эта близость определяется количеством мутаций.

Как определяется направление мутаций? Почему дерево гаплогрупп изображают направленным?

Как расстояние между гаплогруппами переводится в конкретное время расхождения? Объясните пожалуйста методику на пальцах. И как оценивать надежность/ошибку подобных датировок?


Оффлайн katonАвтор темы

  • Сообщений: 2
  • Рейтинг +1/-0
Re: Про деревья гаплогрупп
« Ответ #2 : 18 Май 2011, 18:43:41 »
2 Centurion: Там ответов на мои вопросы нет.
В Вашей манере могу уточнить, что мои вопросы сводятся
к этому http://www.baurum.ru/mathematics/?cat=theory-probability&id=3831
и этому http://book.itep.ru/10/grap1021.htm.

---------------

Если же не переводить общение в пустое семантическое множество, то попробую ещё раз сформулировать вопросы простым языком:

Есть дерево, построенное на основе анализа взаимной близости элементов. Без задания направления связей между элементами или априорного задания корневого элемента оно остается ненаправленным.
При этом чисто математически ненаправленное дерево можно абсолютно эквивалентно перерисовать изобразив корневым вообще-то любой элемент.

Вот меня и интересует (хотя бы в общих чертах) мотивация локализации корневых элементов: у-Адам на вилке A^B, м.Ева на вилке L0^L1.
Если мотивацией служат соображения вероятностной оценки дерева, то хочется понять какая в итоге получается вероятность правильности этих локализаций.

А второй мой вопрос как раз по вероятностным оценкам. Например, когда приводится какая-либо цифра вроде "время расхождения гаплогруп 10000лет", то как на самом деле трактовать эту цифру?
Как мат ожидание на равномерном распределении? Т.е. что на самом деле расхождение произошло в период с 9000 до 10000 лет с вероятностью не более 10%?

Оффлайн I2a1a

  • ...
  • Сообщений: 10999
  • Страна: ee
  • Рейтинг +755/-8
Re: Про деревья гаплогрупп
« Ответ #3 : 19 Май 2011, 06:45:35 »
2 Centurion: Там ответов на мои вопросы нет.
В Вашей манере могу уточнить, что мои вопросы сводятся

На русском языке литературы по основам кладистики, филогенетики и биоинформатики очень мало.
Если интересует, могу дать ссылки на англоязычные математические работы, где содержатся ответы на Ваши вопросы.

Что касается
Цитировать
мотивации локализации корневых элементов: у-Адам на вилке A^B, м.Ева на вилке L0^L1.

то эта мотивация определяется биологическими фактами.

Оффлайн Clavis

  • Сообщений: 1543
  • Страна: ru
  • Рейтинг +102/-0
  • y+mito-search: RK448
    • Семёнов Михаил Юрьевич домашняя страничка
  • Y-ДНК: G2a2b2a1a1a2a (L1264+)
  • мтДНК: HV9, ранее известная как HV3a
Re: Про деревья гаплогрупп
« Ответ #4 : 19 Май 2011, 07:29:37 »
Как определяется направление мутаций? Почему дерево гаплогрупп изображают направленным?
Вопрос-то вполне разумный и ответ не лежит на поверхности. Но кое-что на сайте gentis объясняется. Например:
Цитировать
..В каком порядке происходили мутации в линии Taxon3? Ответить на данный вопрос, имея в наличии только указанный элайнмент, невозможно, например сначала могла произойти мутация в 3-ей вариабельной позиции, а затем в 4-ой, либо наоборот, сначала в 4-ой а затем в 3-ей, или наконец, обе мутации могли произойти одновременно при одной трансмиссии, хотя это и маловероятно. Однако, если бы в нашем элайнменте присутствовал такой сиквенс:

Taxon4 AGCCTGAATCGTATTAGCATGCA

то обнаружим, что он лежит "на полпути" между вариантом Taxon3 и общим предком Anc, имея только одну мутировавшую позицию - 4-ую. Таким образом, сиквенс Taxon4 - предок сиквенса Taxon3, что не мешает обоим "жить" в одно время, ведь мы сейчас рассматриваем не реальные организмы, а участки их ДНК, которые могут мутировать с разной скоростью, вследствие чего среди живых потомков Taxon4 есть как неизменные, так и мутировавшие до состояния Taxon3. Более того, среди ныне живущих организмов вполне может встретиться и носитель предкового типа Anc, хотя со временем количество таких неизмененных вариантов убывает.

Итак, мы провели простейшую филогенетическую реконструкцию - восстановили вид общего предка трех сиквенсов, при этом столкнулись с неопределенностью порядка возникновения мутаций и видели, как добавление новых данных может изменить точность нашего анализа. Изучением истории генов по ДНК занимается молекулярная филогенетика, в которой разработаны практические методы построения таких реконструкций - филогенетических деревьев, которые описывают развитие сиквенсов от древнего предка к его ныне живущим потомкам. Обсуждение методов построения деревьев выходит за рамки нашего краткого пособия, однако ниже мы рассмотрим еще несколько вопросов, относящихся к филогенетике, понимание которых принципиально даже для начинающего специалиста по молекулярной генеалогии.
А Вы, уважаемый katon, отмахнулись от этой ссылки и никак ее не прокомментировали  :(
Как расстояние между гаплогруппами переводится в конкретное время расхождения? Объясните пожалуйста методику на пальцах. И как оценивать надежность/ошибку подобных датировок?
На примере митохондриальных датировок. Сравнивая африканские и не-африканские  митохондриальные хромосомы, выделяют набор мутаций, который произошел вне Африки. Конечно, в каждой прямой женской линии свой набор и свое количество мутаций, но можно посчитать среднее и доверительный интервал этой средней величины. Далее, по археологическим находкам мы знаем, что успешный выход наших предков из Африки произошел примерно 70 тысяч лет назад, делим его на среднее число не-африканских мутаций и получаем число лет на мутацию. Если  70 тысяч лет будет пересмотрено археологами, то и скорость мутаций пропорционально будет пересмотрена. Теперь мы имеем примерное время ветвления митохондриального дерева. Естественно, мутации происходили не с равными интервалами времени, а как любое случайное событие (вспышка новой звезды, падение метеорита...), поэтому и датировка узлов дерева весьма приблизительна.
« Последнее редактирование: 19 Май 2011, 07:54:57 от Clavis »

Оффлайн VVR

  • ...
  • Сообщений: 2723
  • Страна: ua
  • Рейтинг +615/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Re: Про деревья гаплогрупп
« Ответ #5 : 19 Май 2011, 11:41:55 »
Попробую объяснить на примере Y-дерева.
Есть такое понятие, как SNP. По русски упрощённо называется снип. Явление очень редкое, как правило каждый снип за историю человечества образовался один раз.

Начальной точкой дерева является Y-Адам, который является ближайшим общим предком всех мужчин Земли по прямой мужской линии. Его предки тоже являются общими, но не ближайшими.
От него по дереву отходит две выживших линии. Одну обозначим условно Ю, вторую не-Ю. Соответственно все ныне живущие будут принадлежать либо к линии Ю, либо к линии не-Ю. Тогда, если это действительно начальная точка, то у всех Ю будет снип(группа снипов), которых нет ни у кого из не-Ю. А у всех не-Ю снип(группа снипов), которых нет ни у кого из Ю.
Есть только одно разветвление, для которого это условие выполняется полностью - А и не-А. Не-А на Y-дереве обозначаются ВТ.

Посмотрите на дерево. У всех А есть снипы   M91 и P97, которых нет ни у кого из ВТ. У всех ВТ есть снипы  Page65.1/SRY1532.1/SRY10831.1, M42, M94, M139, M299. Этих снипов нет ни у кого из А.

Если мы возьмём любую другую точку дерева условие полностью выполняться не будет. Например. У всех Q есть снип М242, которого нет ни у кого из не-Q. Но у всех не-Q нет ни одного общего снипа.

Следующее разветвление на схеме дерева B-CF. Снипы ВТ для них общие, т.к. они входят в эту сводную гаплогруппу. Далее у всех В есть снипы M60, M181/Page32, P85, P90, которых нет ни у кого из CF. У всех CF есть снипы  M168, M294, P9.1, которых нет ни у кого из В.Таким образом выстраивается всё дерево.

Вероятность с учётом всей цепочки снипов - 100%.


Оффлайн I2a1a

  • ...
  • Сообщений: 10999
  • Страна: ee
  • Рейтинг +755/-8
Re: Про деревья гаплогрупп
« Ответ #6 : 19 Май 2011, 11:44:48 »
Думаю, что катона интересует математическое обоснование направленности дерев, т.е то что в теории графов называется directed graph.

Оффлайн wertner

  • ...
  • Сообщений: 1404
  • Страна: ru
  • Рейтинг +321/-0
    • YFull
  • Y-ДНК: E-V13->E-S2972->E-Z16661
  • мтДНК: U4a (xU4a3)
Re: Про деревья гаплогрупп
« Ответ #7 : 19 Май 2011, 21:32:00 »
Посмотрите на дерево. У всех А есть снипы   M91 и P97, которых нет ни у кого из ВТ. У всех ВТ есть снипы  Page65.1/SRY1532.1/SRY10831.1, M42, M94, M139, M299. Этих снипов нет ни у кого из А.

Если мы возьмём любую другую точку дерева условие полностью выполняться не будет. Например. У всех Q есть снип М242, которого нет ни у кого из не-Q. Но у всех не-Q нет ни одного общего снипа.
Не соглашусь с этим объяснением.
Разве снип и отсутствие снипа не одно и тоже при неизвестном предковом состоянии? Давайте возьмем для примера не гаплогруппу Q, которая определяется одним снипом, а гаплогруппу H, которая сейчас в ISOGG определяется снипами M69 и M370.
M370 это мутация C->G в позиции 2948598 (по крайней мере, у меня в файлике от 2008 года такая инфа). Предположим, что Y-Адам имел состояние G и обозначим мутацию G->С снипом M370'.
Значит все Н имеют снип M69, а все не-H имеют снип M370' :)

Оффлайн I2a1a

  • ...
  • Сообщений: 10999
  • Страна: ee
  • Рейтинг +755/-8
Re: Про деревья гаплогрупп
« Ответ #8 : 19 Май 2011, 22:02:46 »
Посмотрите на дерево. У всех А есть снипы   M91 и P97, которых нет ни у кого из ВТ. У всех ВТ есть снипы  Page65.1/SRY1532.1/SRY10831.1, M42, M94, M139, M299. Этих снипов нет ни у кого из А.

Если мы возьмём любую другую точку дерева условие полностью выполняться не будет. Например. У всех Q есть снип М242, которого нет ни у кого из не-Q. Но у всех не-Q нет ни одного общего снипа.
Не соглашусь с этим объяснением.
Разве снип и отсутствие снипа не одно и тоже при неизвестном предковом состоянии? Давайте возьмем для примера не гаплогруппу Q, которая определяется одним снипом, а гаплогруппу H, которая сейчас в ISOGG определяется снипами M69 и M370.
M370 это мутация C->G в позиции 2948598 (по крайней мере, у меня в файлике от 2008 года такая инфа). Предположим, что Y-Адам имел состояние G и обозначим мутацию G->С снипом M370'.
Значит все Н имеют снип M69, а все не-H имеют снип M370' :)

Не предположим. :)  Сиквенс Y Адам должен быть (по сравнению с современными людьми) гораздо ближе к сиквенсу высших приматов, которых в данном случае можно принять за корень-outgrpoup.
В отличие от сиквенса Адама (который априори неизвестен), Y-сиквенс высших приматов можно скачать в Генбанке и на специальных проектах и сравнить его (с помощью алгоритма элайнмента) с соответствующими сиквенсами африканских аборигенов гаплогруппы A. Теоретически можно определить консенсусный сиквенс Y Адама.

Насчет мутации  C->G  нужно конечно же иметь ввиду, что это cлучай гомологичной трансверсии, т.е такого типа мутации, вероятность который по сравнению с обычной транзицией намного ниже, хотя размер этой вероятности определить сложно. Поэтому предположение, что гомологичная трансверсия могла произойти дважды за относительно небольшой срок (ок.70-50 тыс.лет) крайне неубедительно. 

Оффлайн wertner

  • ...
  • Сообщений: 1404
  • Страна: ru
  • Рейтинг +321/-0
    • YFull
  • Y-ДНК: E-V13->E-S2972->E-Z16661
  • мтДНК: U4a (xU4a3)
Re: Про деревья гаплогрупп
« Ответ #9 : 19 Май 2011, 22:09:16 »
I2a2a, спасибо х\за пояснения :)

Оффлайн I2a1a

  • ...
  • Сообщений: 10999
  • Страна: ee
  • Рейтинг +755/-8
Re: Про деревья гаплогрупп
« Ответ #10 : 19 Май 2011, 22:22:57 »
x\ -это какая-то опция?

Оффлайн wertner

  • ...
  • Сообщений: 1404
  • Страна: ru
  • Рейтинг +321/-0
    • YFull
  • Y-ДНК: E-V13->E-S2972->E-Z16661
  • мтДНК: U4a (xU4a3)
Re: Про деревья гаплогрупп
« Ответ #11 : 19 Май 2011, 22:24:26 »
x\ -это какая-то опция?
это близость клавиш Backspace и \ на непривычной для меня клавиатуре   :)

Онлайн Farroukh

  • Maternal Y-DNA: R1b-L584
  • ...
  • Сообщений: 11275
  • Страна: az
  • Рейтинг +2021/-15
  • Paternal Mt-DNA: M9a1b1
    • Azerbaijan DNA Project
  • Y-ДНК: E-Y37093
  • мтДНК: F2f
Re: Про деревья гаплогрупп
« Ответ #12 : 19 Ноябрь 2011, 10:48:48 »
Цитировать
мне известно моя "общая" галлогруппа.   Где можно посмотреть, почитать, какой именно snp надо заказывать чтобы более детально

В любом случае, я рекомендую Вам после получения предварительного результата зайти на наш форум и спросить.

В общем случае Вам надо зайти на этот сайт, открыть основную страницу Вашей гаплогруппы (то есть, если Ваш предварительный результат - E1b1b1, то Вы открываете раздел гаплогруппы Е). Там уже Вы находите на древе свою предварительную гаплогруппу и её нисходящие линии. Лучше заказать все разные линии (если таковые есть).

Оффлайн UA6ATG

  • Сообщений: 170
  • Страна: ru
  • Рейтинг +23/-1
  • Y-ДНК: J-M172
Re: Про деревья гаплогрупп
« Ответ #13 : 19 Ноябрь 2011, 10:58:43 »
Я так понимаю там галлогруппа и далее список SNP которые ее подтверждают?

Как пример:
  E1b1a1a1   L86.1, M180/P88, P182, Page66, Z111, Z1132

Я правильно понимаю?

Онлайн Farroukh

  • Maternal Y-DNA: R1b-L584
  • ...
  • Сообщений: 11275
  • Страна: az
  • Рейтинг +2021/-15
  • Paternal Mt-DNA: M9a1b1
    • Azerbaijan DNA Project
  • Y-ДНК: E-Y37093
  • мтДНК: F2f
Re: Про деревья гаплогрупп
« Ответ #14 : 19 Ноябрь 2011, 11:00:18 »
Да, именно так. Но если Вы тестируетесь во ФТДНА, то они как правило предлагают уже стандартный набор нисходящих линий для каждой гаплогруппы.

 

© 2007 Молекулярная Генеалогия (МолГен)

Внимание! Все сообщения отражают только мнения их авторов.
Все права на материалы принадлежат их авторам (владельцам) и сетевым изданиям, с которых они взяты.


Rambler's Top100