АвторТема: Underhill et al. 2009  (Прочитано 19875 раз)

0 Пользователей и 1 Гость просматривают эту тему.

Оффлайн VVR

  • ...
  • Сообщений: 2723
  • Страна: ua
  • Рейтинг +615/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Re: Underhill et al. 2009
« Ответ #30 : 06 Ноябрь 2009, 18:25:19 »
Краткие заметки по приложению к статье.
1)Выделены новые субклады(по последней классификации ISOGG-2009)-
R1a1a6 –снип М434,
R1a1a7- М458,
R1a1a8- Page68 (rs34351054)
2)R1a*(xR1a1) не обнаружено, но типированы R1a1*(xR1a1a),т.е. SRY10831.2 без M17/M198.
Географически их можно разделить на 2 группы – северо-западные – 3 шведа и 1 норвежец, и южные- 1 грек(греческая Македония), 2- Армения и армянская диаспора,1-Иран,1-кабардинец.
3)R1a1a6 –M434 –небольшой локальный субклад, обнаружены в Южном Пакистане и Омане – эти территории разделены Оманским заливом Аравийского моря. Пакистан – белуджи- 5из 9 R1a1, макрани(южные белуджи)- 4 из 15, синдхи 2 из 65, Оман- 3 из 11.
4)R1a1a7-M458. Наибольшее распространение – Польша, чуть меньше Чехия, Словакия,Белоруссия, Германия,ещё меньше  Украина ,Россия,Балканы,Балтия, Дания, Голландия, Швеция. Единичные случаи – Кавказ, Турция, Южная Сибирь(хакасс?) Представителей субклада не обнаружено как на Западе ареала R1a1a –Британия, Франция, Испания, Италия, так и на Востоке – Индия, Иран, Пакистан, арабские страны.
По  исследованным маркерам модал субклада отличается от модального R1a1a тремя маркерами. DYS391- у R1a1a в гаплотипах статьи значения от 9 до 12 с преобладающим модальным 11, у R1a1a7- подавляющее большинство 10, с редчайшими 9,11,12. DYS 439 – R1a1a от 8 до 12, модал-10, у R1a1a7- от 9 до 13, модал-11. DYS447- R1a1a-24, R1a1a7-23.Также отличаются модальные значения маркера 389- R1a1a- 13/17, R1a1a7 – 13/16, но здесь значения достаточно близки и разница получается скорее в результате округления.
По  географическому распространению и значениям  маркеров субклад R1a1a7 хорошо идентифицируется с центрально-европейской ветвью из последней  статьи Клёсова и Рожанского(Igor1961). Также хорошая корреляция, учитывая применяемые скорости мутации :D,по возрасту субклада- 2725 + -300 лет по Клёсову,Рожанскому и 7900 лет ;D по Животовскому . 

Оффлайн Овод

  • Главный модератор
  • *****
  • Сообщений: 2158
  • Рейтинг +390/-3
  • Omnia mea mecum porto
  • Y-ДНК: R1a-M198
  • мтДНК: U4a
Re: Underhill et al. 2009
« Ответ #31 : 06 Ноябрь 2009, 18:32:09 »
Спасибо за резюме Приложения, Владимир Викторович. +1

Оффлайн VVR

  • ...
  • Сообщений: 2723
  • Страна: ua
  • Рейтинг +615/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Re: Underhill et al. 2009
« Ответ #32 : 06 Ноябрь 2009, 19:00:26 »
К сожалению не могу пока сопоставить субклад R1a1a7 с деревом mouglley. Пока ещё не разобрался.

Оффлайн mouglley

  • ...
  • Сообщений: 7904
  • Страна: hr
  • Рейтинг +433/-7
  • Я знаю, что познаю всё.
    • Записки Маугли
  • Y-ДНК: N1c1-L1025
  • мтДНК: J1c3
Re: Underhill et al. 2009
« Ответ #33 : 06 Ноябрь 2009, 21:37:28 »
Вот и у Маугли не только свои личные джунгли, но и своё личное дерево появилось.

Оффлайн VVR

  • ...
  • Сообщений: 2723
  • Страна: ua
  • Рейтинг +615/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Re: Underhill et al. 2009
« Ответ #34 : 06 Ноябрь 2009, 22:14:38 »
Виктор, не хотел Вас обидеть. Я конечно имел ввиду дерево R1a, построенное Вами.

Оффлайн татиа

  • Главный модератор
  • *****
  • Сообщений: 5071
  • Страна: 00
  • Рейтинг +654/-0
  • Y-ДНК: R-YP418
  • мтДНК: J1c2c
Re: Underhill et al. 2009
« Ответ #35 : 06 Ноябрь 2009, 22:18:56 »
А я не могу пока сопоставить субклад R1a1a7 с гаплотипами моих родственников :).

Оффлайн mouglley

  • ...
  • Сообщений: 7904
  • Страна: hr
  • Рейтинг +433/-7
  • Я знаю, что познаю всё.
    • Записки Маугли
  • Y-ДНК: N1c1-L1025
  • мтДНК: J1c3
Re: Underhill et al. 2009
« Ответ #36 : 06 Ноябрь 2009, 22:36:20 »
Какая обида? (у меня шутка была).
Типа, анализ и синтез знаний.

Оффлайн татиа

  • Главный модератор
  • *****
  • Сообщений: 5071
  • Страна: 00
  • Рейтинг +654/-0
  • Y-ДНК: R-YP418
  • мтДНК: J1c2c
Re: Underhill et al. 2009
« Ответ #37 : 07 Ноябрь 2009, 09:37:28 »
Вот и уважаемый Лоренс Майка как всегда на острие новостей (мы, правда, его обогнали :) ).

To Project Members of R1a – N Type,

 Researchers have just published the discovery of a new SNP called M458 that divides European R1a1, highlighting Slavic R1a1.  I have attached a PDF copy of the paper; the supplementary figures and tables are here.  Over half of Polish R1a1 is positive for this new SNP, less than half is negative.  Outside of Poland, the percentage positive decreases with distance; but even so:

-       Over half the R1a1 in south and central Germany is M458+

-       Close to half the R1a1 in Slovakia is M458+

-       One-third of the R1a1 in Russian Karelia (near Finland) is M458+

 As far as Dr. Peter Gwozdz and I can tell, types P and N in our project table will probably test positive for M458, and type K will test negative.  But that’s only a prediction, and also leaves a lot of room for discovery in all the Borderline, Remainder, and Unassigned cases.  (I have attached a copy of our current project table.)

Since your classification in our table is N Type, you are an excellent candidate to test positive for M458.  The SNP test itself is $29, but there is an additional one-time $9.50 transfer fee for those who have never ordered an Advanced or Deep Clade test before.  If you wish to order:

1)    Enter your FTDNA account.

2)    Click on “Order Tests & Upgrades”.

3)    On the next page, click on “Go To Advanced Orders”.

4)    On the next page, check the box for “SNP”.

5)    Search for “M458” and check its box.  I do not recommend the other two SNPs, L12 and M434.  L12 has only been found in one individual, and M434 has only been found in small percentages in Pakistan and Oman.

6)    Scroll to the bottom and click the “Next” button.

7)    On the next page, enter your credit card information, then click the “Next” button.

8)    On the next page, click the “Finish” button.

 -       Larry Mayka, Volunteer Administrator of the Polish(-Lithuanian-Ukrainian-Belarusian-Latvian) Project


Оффлайн mouglley

  • ...
  • Сообщений: 7904
  • Страна: hr
  • Рейтинг +433/-7
  • Я знаю, что познаю всё.
    • Записки Маугли
  • Y-ДНК: N1c1-L1025
  • мтДНК: J1c3
Re: Underhill et al. 2009
« Ответ #38 : 07 Ноябрь 2009, 09:42:28 »
Если именно этот образец Во отправили в 23&me, может быть, этот снип там найдут?

Интересно, какой шифр в формате rsXXXXX у M458?

Оффлайн VVR

  • ...
  • Сообщений: 2723
  • Страна: ua
  • Рейтинг +615/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Re: Underhill et al. 2009
« Ответ #39 : 07 Ноябрь 2009, 12:28:50 »

Интересно, какой шифр в формате rsXXXXX у M458?
M434 unassigned R1a1a6 G to A 325* 213 CCAAAATTAGTGGGGAATAGT GATCACCCAGGGTCTGGAGTT this study
У последних трёх шифр rs пока не определён

Оффлайн Lifanov

  • Сообщений: 240
  • Рейтинг +60/-0
  • Парадигма-то другая...
    • База YDNA
  • Y-ДНК: R1a1
  • мтДНК: L2a
Re: Underhill et al. 2009
« Ответ #40 : 07 Ноябрь 2009, 13:22:56 »
Вот и уважаемый Лоренс Майка как всегда на острие новостей (мы, правда, его обогнали :) ).

To Project Members of R1a – N Type,

 Researchers have just published the discovery of a new SNP called M458 that divides European R1a1, highlighting Slavic R1a1.


-       Over half the R1a1 in south and central Germany is M458+

-       Close to half the R1a1 in Slovakia is M458+

-       One-third of the R1a1 in Russian Karelia (near Finland) is M458+

Не выдержал я, заказал 458-й. Посмотрим, чего будет. Ожидаю положительный :)

Оффлайн VVR

  • ...
  • Сообщений: 2723
  • Страна: ua
  • Рейтинг +615/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Re: Underhill et al. 2009
« Ответ #41 : 07 Ноябрь 2009, 13:46:53 »

Не выдержал я, заказал 458-й. Посмотрим, чего будет. Ожидаю положительный :)
Посмотрел Ваш гт. Думаю вероятность положительного теста достаточно высокая.

Оффлайн Centurion

  • 100% Earth (Solar System) genofond
  • Администратор
  • *****
  • Сообщений: 10074
  • Страна: ru
  • Рейтинг +567/-2
Re: Underhill et al. 2009
« Ответ #42 : 07 Ноябрь 2009, 22:57:51 »
Саша, а если у меня Deep Clade уже заказан и результат будет в конце месяца,
мне ведь тогда 458-й не нужен? Или нужен?
Уверен, что он не входил в ТУ панель снипов. Его только после выхода статьи включат. Или отдельно пойдет.

Оффлайн татиа

  • Главный модератор
  • *****
  • Сообщений: 5071
  • Страна: 00
  • Рейтинг +654/-0
  • Y-ДНК: R-YP418
  • мтДНК: J1c2c
Re: Underhill et al. 2009
« Ответ #43 : 07 Ноябрь 2009, 23:04:59 »
Роман, хотела именно от Вас скрыть, что снова интересуюсь тестированием  :(,
даже убрала свой пост...  :-\
Должна признаться, как на духу: я его заказала. В смысле 458-й.
Я не виновата, Вы же знаете, что я серьезно инфицирована, я так просила меня контролировать!  :o
И вот результат - сорвалась.
Во всем виноват Лифанов.

Оффлайн татиа

  • Главный модератор
  • *****
  • Сообщений: 5071
  • Страна: 00
  • Рейтинг +654/-0
  • Y-ДНК: R-YP418
  • мтДНК: J1c2c
Re: Underhill et al. 2009
« Ответ #44 : 09 Ноябрь 2009, 08:26:41 »
Смотрите, какая информация пришла мне от админа R1a:

There is (finally!) some hope for sorting out our R1a subclades!  M458--available for testing for $29--can help sort eastern & western R1as.  Several people in the project have recently ordered it--I'm going to take the plunge tonite...

Also, for anyone who is a member of ISOGG (International Society of Genetic Genealogists), the next issue of the Journal (JOGG) will have more info on how to separate R1as by STRs (STRs are what you have already tested).  Watch for the next JOGG!  (If you are not a member, and you are interested in genetic genealogy, you may want to join.  It's free! http://www.isogg.org/  Resources, mailing list, speakers list, consultants, the Journal, events, Famous DNA, etc)


© 2007 Молекулярная Генеалогия (МолГен)

Внимание! Все сообщения отражают только мнения их авторов.
Все права на материалы принадлежат их авторам (владельцам) и сетевым изданиям, с которых они взяты.

Rambler's Top100