АвторТема: Z92 и его снипы  (Прочитано 178912 раз)

0 Пользователей и 1 Гость просматривают эту тему.

Оффлайн LeslaАвтор темы

  • Главный модератор
  • *****
  • Сообщений: 8672
  • Страна: ru
  • Рейтинг +2055/-9
  • FTDNA: 154400 (Big Y - 283049)
  • Y-ДНК: R1a-YP682 (VK01/VK03+)
Re: Z92 и его снипы
« Ответ #1425 : 16 Декабрь 2017, 21:48:51 »
Гляжу и под A8998 новый подуровень нарисовали - BY29708.
При том, что все протестированные Big Y представители A8998, свои Бамы в YFull загрузили и никаких других общих снипов найдено не было.

Оффлайн LeslaАвтор темы

  • Главный модератор
  • *****
  • Сообщений: 8672
  • Страна: ru
  • Рейтинг +2055/-9
  • FTDNA: 154400 (Big Y - 283049)
  • Y-ДНК: R1a-YP682 (VK01/VK03+)
Re: Z92 и его снипы
« Ответ #1426 : 16 Декабрь 2017, 22:08:04 »
Гляжу и под A8998 новый подуровень нарисовали - BY29708.
Туда поместили 247625 (Сарайкин) и N182384   (Taevere-Gruft).
Общие снипы BY29708 и BY29742.

Оффлайн LeslaАвтор темы

  • Главный модератор
  • *****
  • Сообщений: 8672
  • Страна: ru
  • Рейтинг +2055/-9
  • FTDNA: 154400 (Big Y - 283049)
  • Y-ДНК: R1a-YP682 (VK01/VK03+)
Re: Z92 и его снипы
« Ответ #1427 : 17 Декабрь 2017, 14:37:23 »
Гляжу и под A8998 новый подуровень нарисовали - BY29708.
Туда поместили 247625 (Сарайкин) и N182384   (Taevere-Gruft).
Общие снипы BY29708 и BY29742.
По инсайдерской информации эти снипы плохого качества.

Оффлайн Елена Александровна

  • Сообщений: 2709
  • Страна: by
  • Рейтинг +605/-2
  • U5a1d2a1 Гедматч - M125805
  • Y-ДНК: R1a1a: отец 248308, сын 260304, дед по маме 249367
  • мтДНК: U5a1d2a1 - я; МЖМЖ U5
Re: Z92 и его снипы
« Ответ #1428 : 17 Декабрь 2017, 15:48:40 »
Я  хочу уточнить:
Чем снипы плохого качества отличаются от хорошего качества?

Просто по продуктам питания или одежде - понятно.
А тут?
В чем отличия?

Оффлайн Semargl

  • "El sueño de la razón produce monstruos" ©
  • Модератор
  • *****
  • Сообщений: 5182
  • Страна: hr
  • Рейтинг +2433/-5
  • www.semargl.me
    • www.semargl.me
  • Y-ДНК: R1a [CTS3402+]
  • мтДНК: U4a2g
Re: Z92 и его снипы
« Ответ #1429 : 17 Декабрь 2017, 16:00:57 »
Я  хочу уточнить:
Чем снипы плохого качества отличаются от хорошего качества?

Просто по продуктам питания или одежде - понятно.
А тут?
В чем отличия?
Цитировать
For situations where the mutation or mutations being submitted to the ISOGG tree based only on next-generation sequencing the mutation site and its results must meet the following criteria pertaining to the findings in the individual or individuals who have the mutation in each sample:
1.   The total number of reads for that site in a sample must be at least four.

2.   The percentage of reads showing the mutation must be 100% for less than 21 reads. The number allowed for 21-40 reads is one divergent read, and 2 divergent reads allowed for 41-50 reads and at least 95% for more than 50. Any reads with a mapping quality score less than 10 can be ignored in meeting the criteria of this paragraph.

3.   The total number of reads cannot exceed four times the coverage of the testing. For example, for 50x coverage, the total number of reads at the site cannot exceed 200. If the laboratory is providing different coverage than advertised, the total number of reads should be adjusted accordingly.

4.   The mutation site can already be listed on the ISOGG tree only in three or less locations.

5.   The mapping quality for the site must average at least 10. The percentage of reads with mapping quality less than 10 at the site must not exceed 10% of the total reads.

6.   When 500 adjacent base pairs are viewed with the mutation site in the center, the same sequence cannot appear at another chromosome site where 95.5% or more of the base pairs are in the same sequence. This applies only to those displayed comparisons where the number of base pairs compared are 500 or almost 500 in number, and not for smaller numbers.

7.   No additional called mutations for that individual within 20 base pairs of the submitted mutation site.

8.   The mutation site must not be part of a series of repeated alleles. And if part of a segment where the same allele is repeated, this segment must not exceed 6 alleles of the same type.

If Sanger sequencing results show next-generation sequencing information to be incorrect, an item submitted under this section is to be removed from the tree.

If all criteria under this section are met except for minimum number of reads in one of the samples, the mutation may be added to the tree, but ^ is to follow the name of the mutation and this will be defined on the page as not yet having minimum number of reads.
https://isogg.org/tree/ISOGG_SNP_Requirements.html
В данном случае они не удовлетворяют критериям в пункте 6. Такие снипы могут давать как ложные положительные, так и ложные отрицательные результаты, что не позволяет доверять структуре филогенетического дерева, построенного с учетом таких снипов. Если высокая гомология иногда может быть нормально обработана в тестах NGS, типа Big Y, то при тестировании по Сангеру результат будет неоднозначный. Поэтому например Томас Кран не принимает такие снипы в YSEQ. Можете попробовать)
Что касается упомянутых снипов, то первый имеет гомологию 100%, а второй выше 95%. Первый может быть обработан в тестах NGS. Второй даже в NGS тестах выдает неоднозначные результаты.

Оффлайн Елена Александровна

  • Сообщений: 2709
  • Страна: by
  • Рейтинг +605/-2
  • U5a1d2a1 Гедматч - M125805
  • Y-ДНК: R1a1a: отец 248308, сын 260304, дед по маме 249367
  • мтДНК: U5a1d2a1 - я; МЖМЖ U5
Re: Z92 и его снипы
« Ответ #1430 : 17 Декабрь 2017, 17:03:19 »
Интересно у нас русскоязычный сайт или англоязычный?
Пожалуйста переведите.
Гугл может перевести с ошибками.

Вы даете ответ, как для генетиков.
А попроще?

И с другими фирмами я не работала и  работать в ближайшем будущем не буду.
Мне хватает FTDNA и YFull
« Последнее редактирование: 17 Декабрь 2017, 17:09:24 от Елена Александровна »

Оффлайн FELIX

  • Сообщений: 2407
  • Страна: ru
  • Рейтинг +699/-3
  • Y-ДНК: R-YP569
  • мтДНК: U5a1a1b
Re: Z92 и его снипы
« Ответ #1431 : 17 Декабрь 2017, 17:17:42 »
Елена Александровна!

Если коротко, то эти снипы плохо читаются или даже неверно. И изменение метода исследований не очень помогает.

Оффлайн Semargl

  • "El sueño de la razón produce monstruos" ©
  • Модератор
  • *****
  • Сообщений: 5182
  • Страна: hr
  • Рейтинг +2433/-5
  • www.semargl.me
    • www.semargl.me
  • Y-ДНК: R1a [CTS3402+]
  • мтДНК: U4a2g
Re: Z92 и его снипы
« Ответ #1432 : 18 Декабрь 2017, 09:07:00 »
Если очень коротко и упрощенно, то гомология = похожесть. В данном контексте под гомологией понимается похожесть последовательностей нуклеотидов. Общепринято считать критерием качества что у участка со снипом на Y хромосоме не будет найдено копий на Y хромосоме или на других хромосомах, которые будут похоже более чем на 95%. Участок для поиска похожести принято брать длиной 1000 нуклеотидов (500 влево и 500 вправо от снипа).
Для примера, две следующих последовательности в 60 нуклеотидов полностью идентичны, то есть похожесть 100%:
TTTCTTTGAGGTCTTGTTAAGTAGGACCTTAGCAGCCTCGGCCTAGATCTAATCTTCCAC
TTTCTTTGAGGTCTTGTTAAGTAGGACCTTAGCAGCCTCGGCCTAGATCTAATCTTCCAC

В примере ниже похожесть равна 98.33%, не совпадает 1 символ из 60.
ATTGAGCTATGTTCTAAGATGCAGTTAAATTATCTGGAAAGATTTTGGTTCTTTGAGGGT
ATTGAGCTATGTTCTAAGATGTAGTTAAATTATCTGGAAAGATTTTGGTTCTTTGAGGGT

Чем опасна гомология? К примеру в тестах NGS (Big Y и тп). Во время выравнивания последовательностей программа может по некоторым причинам поместить одну похожую последовательность на место другой. Чем короче последовательность тем вероятнее такой вариант. В результате мы получим несуществующий в реальности SNP. Посмотрите на мой второй пример. Если поместить вторую последовательность на место первой, то получим SNP с мутацией C->T, но на самом деле этого SNP не существует, это всего лишь ошибка программы выравнивания из-за несовершенства технологий.

Это не значит что все снипы на гомологичных участках плохие - просто к ним надо относиться с осторожностью. В YFull показаны приватные снипы, которые имеют высокую степень гомологии - они отмечены красной литерой "H". Такой приватный снип скорее всего не будет принят в YSEQ, да и при включении его в SNP pack в FTDNA будет давать неправильные результаты - примеров множество. В дерево обычно такие SNP не включаются, но есть и некоторые исключения. Как я говорил выше, BY29708 неплохо определяется в bam'e, хотя и имеет высокую гомологию. Мы его включили в следующую версию дерева, но если с ним будут проблемы, то в дальнейшем он будет удален.

Оффлайн LeslaАвтор темы

  • Главный модератор
  • *****
  • Сообщений: 8672
  • Страна: ru
  • Рейтинг +2055/-9
  • FTDNA: 154400 (Big Y - 283049)
  • Y-ДНК: R1a-YP682 (VK01/VK03+)
Re: Z92 и его снипы
« Ответ #1433 : 18 Декабрь 2017, 21:41:39 »
B84535 Sypaila из Литвы: YP569* [Y11268- YP682-]
А теперь пишут Y11268+

Оффлайн Feroce

  • Сообщений: 780
  • Страна: ru
  • Рейтинг +164/-0
    • Бессоновы/Безсоновы
  • Y-ДНК: R1a-Z92 (YP6504->BY30750)
Re: Z92 и его снипы
« Ответ #1434 : 18 Декабрь 2017, 22:08:21 »
B84535 Sypaila из Литвы: YP569* [Y11268- YP682-]
А теперь пишут Y11268+
Где пишут? А то он возможно ещё и YP6504.
« Последнее редактирование: 18 Декабрь 2017, 22:20:03 от Feroce »

Оффлайн LeslaАвтор темы

  • Главный модератор
  • *****
  • Сообщений: 8672
  • Страна: ru
  • Рейтинг +2055/-9
  • FTDNA: 154400 (Big Y - 283049)
  • Y-ДНК: R1a-YP682 (VK01/VK03+)
Re: Z92 и его снипы
« Ответ #1435 : 18 Декабрь 2017, 23:05:29 »
B84535 Sypaila из Литвы: YP569* [Y11268- YP682-]
А теперь пишут Y11268+
Где пишут? А то он возможно ещё и YP6504.
В проекте R1a этот снип у него зеленый.

Оффлайн Feroce

  • Сообщений: 780
  • Страна: ru
  • Рейтинг +164/-0
    • Бессоновы/Безсоновы
  • Y-ДНК: R1a-Z92 (YP6504->BY30750)
Re: Z92 и его снипы
« Ответ #1436 : 19 Декабрь 2017, 00:18:21 »
B84535 Sypaila из Литвы: YP569* [Y11268- YP682-]
А теперь пишут Y11268+
Где пишут? А то он возможно ещё и YP6504.
В проекте R1a этот снип у него зеленый.
Но в таблице он ещё не в Y11268

Оффлайн LeslaАвтор темы

  • Главный модератор
  • *****
  • Сообщений: 8672
  • Страна: ru
  • Рейтинг +2055/-9
  • FTDNA: 154400 (Big Y - 283049)
  • Y-ДНК: R1a-YP682 (VK01/VK03+)
Re: Z92 и его снипы
« Ответ #1437 : 19 Декабрь 2017, 00:42:47 »
B84535 Sypaila из Литвы: YP569* [Y11268- YP682-]
А теперь пишут Y11268+
Где пишут? А то он возможно ещё и YP6504.
В проекте R1a этот снип у него зеленый.
Но в таблице он ещё не в Y11268
Смотря где Вы смотрите. В проекте R1a по прогнозу он уже даже в YP6504.


Оффлайн Лекомцев Сана

  • Сообщений: 229
  • Страна: ru
  • Рейтинг +67/-2
  • 95% European 5% East Asian T326591
  • Y-ДНК: R1a z92 cts9551 cts214 cts5149 Y37888 BY30791
  • мтДНК: T2
Re: Z92 и его снипы
« Ответ #1438 : 19 Декабрь 2017, 06:08:38 »
Если очень коротко и упрощенно, то гомология = похожесть. В данном контексте под гомологией понимается похожесть последовательностей нуклеотидов. Общепринято считать критерием качества что у участка со снипом на Y хромосоме не будет найдено копий на Y хромосоме или на других хромосомах, которые будут похоже более чем на 95%. Участок для поиска похожести принято брать длиной 1000 нуклеотидов (500 влево и 500 вправо от снипа).
Для примера, две следующих последовательности в 60 нуклеотидов полностью идентичны, то есть похожесть 100%:
TTTCTTTGAGGTCTTGTTAAGTAGGACCTTAGCAGCCTCGGCCTAGATCTAATCTTCCAC
TTTCTTTGAGGTCTTGTTAAGTAGGACCTTAGCAGCCTCGGCCTAGATCTAATCTTCCAC

В примере ниже похожесть равна 98.33%, не совпадает 1 символ из 60.
ATTGAGCTATGTTCTAAGATGCAGTTAAATTATCTGGAAAGATTTTGGTTCTTTGAGGGT
ATTGAGCTATGTTCTAAGATGTAGTTAAATTATCTGGAAAGATTTTGGTTCTTTGAGGGT

Чем опасна гомология? К примеру в тестах NGS (Big Y и тп). Во время выравнивания последовательностей программа может по некоторым причинам поместить одну похожую последовательность на место другой. Чем короче последовательность тем вероятнее такой вариант. В результате мы получим несуществующий в реальности SNP. Посмотрите на мой второй пример. Если поместить вторую последовательность на место первой, то получим SNP с мутацией C->T, но на самом деле этого SNP не существует, это всего лишь ошибка программы выравнивания из-за несовершенства технологий.

Это не значит что все снипы на гомологичных участках плохие - просто к ним надо относиться с осторожностью. В YFull показаны приватные снипы, которые имеют высокую степень гомологии - они отмечены красной литерой "H". Такой приватный снип скорее всего не будет принят в YSEQ, да и при включении его в SNP pack в FTDNA будет давать неправильные результаты - примеров множество. В дерево обычно такие SNP не включаются, но есть и некоторые исключения. Как я говорил выше, BY29708 неплохо определяется в bam'e, хотя и имеет высокую гомологию. Мы его включили в следующую версию дерева, но если с ним будут проблемы, то в дальнейшем он будет удален.

позиция 11321478       C     A  Высокая ещё написано у обоих      снип BY-26184 . он и у меня и у Корзенникова есть . но он упоминается у нас у обоих в приватных . он может быть ложным ?
позиции других общих снипов с Корзенниковым которые имеют абвиатуру BY к сожалению не указаны .
« Последнее редактирование: 19 Декабрь 2017, 06:17:49 от Лекомцев Сана »

Оффлайн Semargl

  • "El sueño de la razón produce monstruos" ©
  • Модератор
  • *****
  • Сообщений: 5182
  • Страна: hr
  • Рейтинг +2433/-5
  • www.semargl.me
    • www.semargl.me
  • Y-ДНК: R1a [CTS3402+]
  • мтДНК: U4a2g
Re: Z92 и его снипы
« Ответ #1439 : 19 Декабрь 2017, 07:01:58 »
позиция 11321478       C     A  Высокая ещё написано у обоих      снип BY-26184 . он и у меня и у Корзенникова есть . но он упоминается у нас у обоих в приватных . он может быть ложным ?
Да, вероятность есть. В этой позиции читаются все возможные значения - A, C, G, T. Гомологии здесь нет, но "снип" находится в регионе Yq11.21, который расположен близко к центромере и сложен для выравнивания.
Параметров для фильтрации много. Если выводить все отличия от референса, давать им имя и пытаться повесить их на дерево, то ничего хорошего из этого не выйдет.

 

© 2007 Молекулярная Генеалогия (МолГен)

Внимание! Все сообщения отражают только мнения их авторов.
Все права на материалы принадлежат их авторам (владельцам) и сетевым изданиям, с которых они взяты.


Rambler's Top100