АвторТема: N1-Z1936 Savo LLY22g recLOH [L708+,L1026+,L1022-,L550-]  (Прочитано 5365 раз)

0 Пользователей и 1 Гость просматривают эту тему.

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • Модератор
  • *****
  • Сообщений: 8714
  • Страна: gt
  • Рейтинг +636/-6
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: N1-Z1936 Savo LLY22g recLOH [L708+,L1026+,L1022-,L550-]
« Ответ #15 : 26 Февраль 2012, 15:00:20 »
Цитировать
M
Mutation так обозначается
Нет, это что-то другое - во всех других случаях показан измененный элемент.

Оффлайн Centurion

  • 100% Earth (Solar System) genofond
  • Администратор
  • *****
  • Сообщений: 10121
  • Страна: ru
  • Рейтинг +563/-2
Re: N1-Z1936 Savo LLY22g recLOH [L708+,L1026+,L1022-,L550-]
« Ответ #16 : 26 Февраль 2012, 15:29:08 »
Цитировать
M
Mutation так обозначается
Нет, это что-то другое - во всех других случаях показан измененный элемент.
можете не верить - дело ваше  :)

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • Модератор
  • *****
  • Сообщений: 8714
  • Страна: gt
  • Рейтинг +636/-6
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: N1-Z1936 Savo LLY22g recLOH [L708+,L1026+,L1022-,L550-]
« Ответ #17 : 26 Февраль 2012, 16:13:43 »

Цитировать
M
Mutation так обозначается
Нет, это что-то другое - во всех других случаях показан измененный элемент.
можете не верить - дело ваше  :)

Вот этот же участок у 117443 Setälä, Finland N1b
AGATTTAGATAATTCTGAAAAGC


Т.е. показана мутация C на A.



А вот тот же участок у 154501 Shikalov, Russia – карельская ветвь N1c1

AGCTTTAGATAATTCTGAAAAGC

Т.е. LLY22g_2 C- - мутации нет.

У других представителей финно-карельской ветви, протестированных по WTY (N25747 Pyykkonen, Finland и 141818 Wayrynen, Finland)  эти участки в финче не показываются, поэтому непонятно, что там и больше из этой ветви никто непроверялся.
« Последнее редактирование: 26 Февраль 2012, 16:21:34 от Yurgan »

Оффлайн Centurion

  • 100% Earth (Solar System) genofond
  • Администратор
  • *****
  • Сообщений: 10121
  • Страна: ru
  • Рейтинг +563/-2
Re: N1-Z1936 Savo LLY22g recLOH [L708+,L1026+,L1022-,L550-]
« Ответ #18 : 26 Февраль 2012, 16:32:05 »
я показал нукл. замены в positive исходя из reference

Оффлайн mouglleyАвтор темы

  • Модератор
  • *****
  • Сообщений: 7935
  • Страна: hr
  • Рейтинг +433/-7
  • Я знаю, что познаю всё.
    • Записки Маугли
  • Y-ДНК: N1c1-L1025
  • мтДНК: J1c3
Re: N1-Z1936 Savo LLY22g recLOH [L708+,L1026+,L1022-,L550-]
« Ответ #19 : 26 Февраль 2012, 17:09:04 »
Вот этот же участок у 117443 Setälä, Finland N1b
AGATTTAGATAATTCTGAAAAGC


Т.е. показана мутация C на A.



А вот тот же участок у 154501 Shikalov, Russia – карельская ветвь N1c1

AGCTTTAGATAATTCTGAAAAGC

Т.е. LLY22g_2 C- - мутации нет.

У других представителей финно-карельской ветви, протестированных по WTY (N25747 Pyykkonen, Finland и 141818 Wayrynen, Finland)  эти участки в финче не показываются, поэтому непонятно, что там и больше из этой ветви никто непроверялся.
Из всех тестированных на финче выложены:

183394 (GRC11055225)
LLY22g_1 T+
LLY22g_2 A+

73958 (GRC012523)
LLY22g_2 A+

То есть, эти снипы довольно-таки непостоянные.

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • Модератор
  • *****
  • Сообщений: 8714
  • Страна: gt
  • Рейтинг +636/-6
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: N1-Z1936 Savo LLY22g recLOH [L708+,L1026+,L1022-,L550-]
« Ответ #20 : 03 Март 2012, 08:47:38 »
Вот этот же участок у 117443 Setälä, Finland N1b
AGATTTAGATAATTCTGAAAAGC


Т.е. показана мутация C на A.



А вот тот же участок у 154501 Shikalov, Russia – карельская ветвь N1c1

AGCTTTAGATAATTCTGAAAAGC

Т.е. LLY22g_2 C- - мутации нет.

У других представителей финно-карельской ветви, протестированных по WTY (N25747 Pyykkonen, Finland и 141818 Wayrynen, Finland)  эти участки в финче не показываются, поэтому непонятно, что там и больше из этой ветви никто непроверялся.
Из всех тестированных на финче выложены:

183394 (GRC11055225)
LLY22g_1 T+
LLY22g_2 A+

73958 (GRC012523)
LLY22g_2 A+

То есть, эти снипы довольно-таки непостоянные.

Очень странно.
Везде в проектах показано, что Shikalov LLY22g+
А он однозначно LLY22g-
154501 Shikalov, Russia – карельская ветвь N1c1
Предковый вариант
AGCTTTAGATAATTCTGAAAAGC

Из всех, прошедших WTY, однозначно LLY22g+ только у
117443 Setälä, Finland N1b
AGATTTAGATAATTCTGAAAAGC

У боьшинства, в том числе 73958 (GRC012523)
там стоит M, K или вообще WK

Это означает, что какая-то мутация есть, но какая конкретно замена не ясно и совсем не означает, что это точно такая  же мутация, как у N1b, где четко виден переход C – A, или G – T.

Но у уважаемого Eugene 183394 (GRC11055225) действительно LLY22g+

AGATTTAGATAATTCTGAAAAGC

Там же рядом находится снип L593_2 ChrY:22432111..22432111
У всех там стоит W, а Setälä – A или T

Финч уважаемого Валихана так и не показывает.

Уважаемый Juhani должен запросить ФТДНА, почему этот участок он не может увидеть в своем финче.
« Последнее редактирование: 03 Март 2012, 09:29:54 от Yurgan »

Оффлайн mouglleyАвтор темы

  • Модератор
  • *****
  • Сообщений: 7935
  • Страна: hr
  • Рейтинг +433/-7
  • Я знаю, что познаю всё.
    • Записки Маугли
  • Y-ДНК: N1c1-L1025
  • мтДНК: J1c3
Re: N1-Z1936 Savo LLY22g recLOH [L708+,L1026+,L1022-,L550-]
« Ответ #21 : 03 Апрель 2012, 11:35:42 »
Выделены в отдельную группу N1c1*(xL550) Savo LLY22g recLOH гаплотипы, у которых снип LLY22g может оказаться изничтоженным:
http://www.semargl.me/ru/dna/ydna/haplotypes/table/366/

Им надо проверить свои LLY22g.

Оффлайн mouglleyАвтор темы

  • Модератор
  • *****
  • Сообщений: 7935
  • Страна: hr
  • Рейтинг +433/-7
  • Я знаю, что познаю всё.
    • Записки Маугли
  • Y-ДНК: N1c1-L1025
  • мтДНК: J1c3

Оффлайн mouglleyАвтор темы

  • Модератор
  • *****
  • Сообщений: 7935
  • Страна: hr
  • Рейтинг +433/-7
  • Я знаю, что познаю всё.
    • Записки Маугли
  • Y-ДНК: N1c1-L1025
  • мтДНК: J1c3
Re: N1-Z1936 Savo LLY22g recLOH [L708+,L1026+,L1022-,L550-]
« Ответ #23 : 03 Октябрь 2012, 18:22:18 »
Новый кандидат на Savo-LLY22g_recLOH 239163 Jan Davidsson, b. 1693, d. 1773 Sweden

Оффлайн mouglleyАвтор темы

  • Модератор
  • *****
  • Сообщений: 7935
  • Страна: hr
  • Рейтинг +433/-7
  • Я знаю, что познаю всё.
    • Записки Маугли
  • Y-ДНК: N1c1-L1025
  • мтДНК: J1c3
Re: N1-Z1936 Savo LLY22g recLOH [L708+,L1026+,L1022-,L550-]
« Ответ #24 : 03 Октябрь 2012, 18:28:05 »
И ещё один: 252159 Antti Vääräin,1652-1740, Vimpeli, Finland

Оффлайн ankr21

  • Сообщений: 2052
  • Страна: ru
  • Рейтинг +416/-0
  • Y-ДНК: I1-L1302
  • мтДНК: U3b1b
Re: N1-Z1936 Savo LLY22g recLOH [L708+,L1026+,L1022-,L550-]
« Ответ #25 : 09 Июль 2018, 21:06:58 »
Тема древняя. Может и не актуально. После апгрейда YF06184 hg19-hg38 вылез LLY22g_2 - одно прочтение.

 

© 2007 Молекулярная Генеалогия (МолГен)

Внимание! Все сообщения отражают только мнения их авторов.
Все права на материалы принадлежат их авторам (владельцам) и сетевым изданиям, с которых они взяты.


Rambler's Top100