АвторТема: Гаплогруппа N в проекте 1K Genomes и HGDP  (Прочитано 32908 раз)

0 Пользователей и 1 Гость просматривают эту тему.

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • Модератор
  • *****
  • Сообщений: 8714
  • Страна: gt
  • Рейтинг +636/-6
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #30 : 23 Сентябрь 2011, 14:18:21 »
Ув.Юрган, откуда данные? Кто обнаружил эти снипы?
Я предпологаю, что данные в том, виде в каком Вы привели, это не совсем снипы, а фрагменты элайнментов, в которых показаны отличающиеся позиции.

http://www.box.net/shared/xm580ycfxq#/shared/xm580ycfxq/[object%20Object]/90777010

Не знаю, как насчет  элайнментов, но среди перечисленных и снипов хватает.
По крайней мере этих переходов  нет ни у одного O.

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • Модератор
  • *****
  • Сообщений: 8714
  • Страна: gt
  • Рейтинг +636/-6
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #31 : 23 Сентябрь 2011, 19:25:09 »
Наконец то нашлось совпадение.  :D
Новый снип L729
Build 36 - ChrY:17941002..17941002
Build 37 - ChrY:19431608..19431608

Найден в новых снипах проекта 1000 genomes

К нему относятся все протестированные N1c1 - обозначены как финны.

HG00358   HG00338   HG00336   HG00271   HG00273   HG00311   HG00183   HG00182   HG00187   HG00375   HG00278   HG00335   HG00188   HG00342   HG00280   HG00369
Кроме них ни у кого этого снипа нет.
 :D :D

Теперь узнать бы, кого еще захватит этот снип.

« Последнее редактирование: 26 Сентябрь 2011, 14:53:02 от Yurgan »

Оффлайн Иван Карцов

  • Сообщений: 346
  • Рейтинг +27/-0
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #32 : 23 Сентябрь 2011, 19:33:34 »
Извиняюсь за вопрос более низкого порядка.
Приведенный список снипов относится к гаплотипам уже содержащимся в проектах (например, финском) и просто не известно к кому именно они относятся или это какая-то новая группа товарищей?
Второй вопрос.
Наименованием и обозначением новых снипов, их систематизацией и т.д. кто-то занимается в "лабораторной" среде или все системно-логические выводы - это исключительно результат работы энтузиастов?
И еще вопрос: эти списки новых снипов -  результаты WTY-тестов, заказанных их обладателями? 

Оффлайн mouglleyАвтор темы

  • Модератор
  • *****
  • Сообщений: 7935
  • Страна: hr
  • Рейтинг +433/-7
  • Я знаю, что познаю всё.
    • Записки Маугли
  • Y-ДНК: N1c1-L1025
  • мтДНК: J1c3
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #33 : 23 Сентябрь 2011, 19:34:38 »
Всех - это сурово.
Вот если бы он не захватил варягов!
Хотя, может быть в их подборку варяги не вошли - их слишком мало.

В таком случае этот снип можно рекомендовать всем N1c1*(xL550)

Оффлайн Eugene

  • Санктпетербурхъ
  • Сообщений: 6060
  • Страна: ru
  • Рейтинг +701/-38
    • N1c1 Y-DNA Project
  • Y-ДНК: N-CTS8173
  • мтДНК: U-C1341T
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #34 : 23 Сентябрь 2011, 19:47:53 »
Наконец то нашлось совпадение.  :D
Новый снип L726
Build 36 - ChrY:17941002..17941002
Build 37 - ChrY:19431608..19431608

Найден в новых снипах проекта 1000 genomes

К нему относятся все протестированные N1c1 - обозначены как финны.

HG00358   HG00338   HG00336   HG00271   HG00273   HG00311   HG00183   HG00182   HG00187   HG00375   HG00278   HG00335   HG00188   HG00342   HG00280   HG00369
Кроме них ни у кого этого снипа нет.
 :D :D

Теперь узнать бы, кого еще захватит этот снип.
Юрган,
Это очень хорошо что Вы за это взялись и уже даже результат одного снипа подтвердился. +2

А там есть в списке среди финнов те у кого L550+? Среди финнов таких немного но могут быть.

Оффлайн I2a1a

  • ...
  • Сообщений: 11074
  • Страна: ee
  • Рейтинг +753/-8
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #35 : 23 Сентябрь 2011, 22:01:38 »
А вот такие структуры из списка VL-снипов вообще не могут считаться снипами.
VL75   Y   4114451      .   CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA   CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG/quote]

Просмотрел в исходнике, там эти вариации обозначены как инделы и/или дупликации. Так что это не снипы. :)

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • Модератор
  • *****
  • Сообщений: 8714
  • Страна: gt
  • Рейтинг +636/-6
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #36 : 24 Сентябрь 2011, 06:25:40 »

Юрган,
Это очень хорошо что Вы за это взялись и уже даже результат одного снипа подтвердился. +2

А там есть в списке среди финнов те у кого L550+? Среди финнов таких немного но могут быть.

К сожалению, этого снипа там нет. Наверное, действительно, в 1000  геномов не тестировали представителей скандинавской и балтской ветвей.
Теперь надо выяснить, не распространяется ли L726 на другие ветви.
Из снипов L там еще присутствуют L392 и L647.  Первый есть у всех N1c1, второй у всех N – равен M231 Page56 Page91
Также выяснил, что снип P27.2_2, который считается определяющим для O3a1a, есть у всех NO
« Последнее редактирование: 24 Сентябрь 2011, 12:30:10 от Yurgan »

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • Модератор
  • *****
  • Сообщений: 8714
  • Страна: gt
  • Рейтинг +636/-6
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #37 : 24 Сентябрь 2011, 06:35:54 »
Извиняюсь за вопрос более низкого порядка.
Приведенный список снипов относится к гаплотипам уже содержащимся в проектах (например, финском) и просто не известно к кому именно они относятся или это какая-то новая группа товарищей?
Второй вопрос.
Наименованием и обозначением новых снипов, их систематизацией и т.д. кто-то занимается в "лабораторной" среде или все системно-логические выводы - это исключительно результат работы энтузиастов?
И еще вопрос: эти списки новых снипов -  результаты WTY-тестов, заказанных их обладателями?

Это список снипов, которые выявили у гаплогрупп N1c1 в проекте 1000 genomes

Кто-то наверное там занимается систематизацией, но медленно, и большое спасибо Greg’у RM, что он вывесил эти данные

http://www.box.net/shared/xm580ycfxq#/shared/xm580ycfxq/[object%20Object]/90777010
По большому счету, у проекта 1000 genomes другие задачи, задача выявления снипов для них не так важна.


Оффлайн Yurgan

  • Кто везёт, тому везёт
  • Модератор
  • *****
  • Сообщений: 8714
  • Страна: gt
  • Рейтинг +636/-6
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #38 : 24 Сентябрь 2011, 07:47:07 »
Робот Юргана

SNP L708
Build 36 ChrY:7689512..7689512
Build 37 ChrY:7629512..7629512
C -> A
Есть у всех финнов N1c1 из 1000 genomes


Т.е. общий снип для всех N1c1


А вот  на эти у меня позиций нет
L734 L735 L736

Оффлайн I2a1a

  • ...
  • Сообщений: 11074
  • Страна: ee
  • Рейтинг +753/-8
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #39 : 24 Сентябрь 2011, 08:03:41 »
По большому счету, у проекта 1000 genomes другие задачи, задача выявления снипов для них не так важна.

Задача проекта как раз сводится к выявлению вариаций генома, одним из типов которой и является снип.

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • Модератор
  • *****
  • Сообщений: 8714
  • Страна: gt
  • Рейтинг +636/-6
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #40 : 24 Сентябрь 2011, 10:50:08 »
По большому счету, у проекта 1000 genomes другие задачи, задача выявления снипов для них не так важна.

Задача проекта как раз сводится к выявлению вариаций генома, одним из типов которой и является снип.
Это не главная их задача, иначе мы уже все погрязли бы в снипах по уши.

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • Модератор
  • *****
  • Сообщений: 8714
  • Страна: gt
  • Рейтинг +636/-6
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #41 : 24 Сентябрь 2011, 10:52:07 »
Похоже, что если какого то снипа в среди найденных 1000 геномами нет, то их нет у финнов N1c1.
Тоже положительная информация для других ветвей N1c1.

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • Модератор
  • *****
  • Сообщений: 8714
  • Страна: gt
  • Рейтинг +636/-6
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #42 : 24 Сентябрь 2011, 11:13:56 »
Я так понял, что если посмотреть геном какого-то финна, то можно и значения локусов узнать.
Скачать то я скачал, а вот как внутрь заглянуть, не пойму.
Расширение *.vcf

Оффлайн Centurion

  • 100% Earth (Solar System) genofond
  • Администратор
  • *****
  • Сообщений: 10121
  • Страна: ru
  • Рейтинг +563/-2
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #43 : 24 Сентябрь 2011, 11:16:08 »
Я так понял, что если посмотреть геном какого-то финна, то можно и значения локусов узнать.
;D это отнюдь не просто... уж снип найти проще в разы

Оффлайн Eugene

  • Санктпетербурхъ
  • Сообщений: 6060
  • Страна: ru
  • Рейтинг +701/-38
    • N1c1 Y-DNA Project
  • Y-ДНК: N-CTS8173
  • мтДНК: U-C1341T
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #44 : 24 Сентябрь 2011, 14:52:21 »
Робот Юргана

SNP L708
Build 36 ChrY:7689512..7689512
Build 37 ChrY:7629512..7629512
C -> A
Есть у всех финнов N1c1 из 1000 genomes
Вы таким образом сэкономили много раз по 29$ и нерезиновые мощности FTDNA :)

 

© 2007 Молекулярная Генеалогия (МолГен)

Внимание! Все сообщения отражают только мнения их авторов.
Все права на материалы принадлежат их авторам (владельцам) и сетевым изданиям, с которых они взяты.


Rambler's Top100