АвторТема: Гаплогруппа N в проекте 1K Genomes и HGDP  (Прочитано 32907 раз)

0 Пользователей и 1 Гость просматривают эту тему.

Оффлайн Valery

  • Сообщений: 5522
  • Страна: 00
  • Рейтинг +435/-6
  • Ultimate Matriarchy
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #15 : 23 Сентябрь 2011, 12:41:43 »
база уже размером зашкаливает ))


тогда уж лучше взимай с нас ежемесячную мзду чем так ограничивать :)

Оффлайн Centurion

  • 100% Earth (Solar System) genofond
  • Администратор
  • *****
  • Сообщений: 10121
  • Страна: ru
  • Рейтинг +563/-2
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #16 : 23 Сентябрь 2011, 12:46:38 »
база уже размером зашкаливает ))


тогда уж лучше взимай с нас ежемесячную мзду чем так ограничивать :)
офф .. на самом деле это не правильно делать цитату всего огромного текста собеседника ради того чтоб написать 1 -2 слова... я лично всегда выделяю и цитирую только тот кусок текста, который комментирую  :) и дело тут не в размере бд

зы я не ограничиваю в тексте - Боже упаси  :) я говорю только про цитирование

Оффлайн I2a1a

  • ...
  • Сообщений: 11074
  • Страна: ee
  • Рейтинг +753/-8
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #17 : 23 Сентябрь 2011, 12:54:22 »
Цитировать
N1c   Tat M46 Page70   Y   14922583

Это позиция (форвард)? В браузер проекта новые данные выведены, где я могу посмотреть готовый элайнмент без каких-либо усилий?

Да, forward strand, поскольку данные проекта 1000геномов в формате Build 37

Цитировать
Current releases of 1000 Genome Project data use NCBI genome build 37  (hg19) and, before you start imputation, you need to ensure that all  your genotypes are reported using build 37 coordinates and on the  forward strand of the reference genome.

Оффлайн I2a1a

  • ...
  • Сообщений: 11074
  • Страна: ee
  • Рейтинг +753/-8
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #18 : 23 Сентябрь 2011, 12:57:17 »
В браузер проекта новые данные выведены, где я могу посмотреть готовый элайнмент без каких-либо усилий?

Это нетрудно сделать, вот Юрган может поделится с Вами опытом.
Скачиваете 100-200 Гигабайтов генотипов, и делайте с ними что хотите,  - хоть элайнмент, хоть фейзинг, хоть импьютинг. :)

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • Модератор
  • *****
  • Сообщений: 8714
  • Страна: gt
  • Рейтинг +636/-6
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #19 : 23 Сентябрь 2011, 12:58:24 »
Цитировать
N1c   Tat M46 Page70   Y   14922583

Это позиция (форвард)? В браузер проекта новые данные выведены, где я могу посмотреть готовый элайнмент без каких-либо усилий?
Я на слух английский плохо понимаю, можно перевести на русский, чего хотели?
Ссылку на файл со всеми вновь выявленными снипами N и O?

Оффлайн I2a1a

  • ...
  • Сообщений: 11074
  • Страна: ee
  • Рейтинг +753/-8
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #20 : 23 Сентябрь 2011, 12:59:36 »
В связи  с тем, что в проекте 1000 геномов снипам, обнаруженнным у N. еще не дали имена, я дал им свои.


Что-то здесь нечисто: не может быть такого количества трансверсий. Большинство снипов - всегда транзиции.
Там были позиции и других снипов (N и О) - полное совпадение.
;D
Ответ в стиле диалога A и B.
A: "Как Вас зовут?"
B: "Трамвай отправляется через 5 минут".

Оффлайн I2a1a

  • ...
  • Сообщений: 11074
  • Страна: ee
  • Рейтинг +753/-8
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #21 : 23 Сентябрь 2011, 13:09:07 »
Цитировать
N1c   Tat M46 Page70   Y   14922583

Это позиция (форвард)? В браузер проекта новые данные выведены, где я могу посмотреть готовый элайнмент без каких-либо усилий?
Я на слух английский плохо понимаю, можно перевести на русский, чего хотели?
Ссылку на файл со всеми вновь выявленными снипами N и O?

Перевожу на русский.
Валерий спрашивает, готов ли элайнмент (например в формате Fasta) для вывода в геномный браузер проекта (браузер выглядит подобным образом),

Оффлайн Valery

  • Сообщений: 5522
  • Страна: 00
  • Рейтинг +435/-6
  • Ultimate Matriarchy
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #22 : 23 Сентябрь 2011, 13:18:09 »
В браузер проекта новые данные выведены, где я могу посмотреть готовый элайнмент без каких-либо усилий?

Это нетрудно сделать, вот Юрган может поделится с Вами опытом.
Скачиваете 100-200 Гигабайтов генотипов, и делайте с ними что хотите,  - хоть элайнмент, хоть фейзинг, хоть импьютинг. :)


учитывая что работать я намерен не более 5 минут, данный вариант не подходит. Я полазил в браузере - там есть эти позиции но там только CEU и прочее старье.

Оффлайн Valery

  • Сообщений: 5522
  • Страна: 00
  • Рейтинг +435/-6
  • Ultimate Matriarchy
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #23 : 23 Сентябрь 2011, 13:23:28 »
Я имел в виду маленький фрагмент элайнмента (выравнивания) окружения снипа дабы убедиться что скажем там где у одних T у других действительно G. Типа:


1 AGGTCATGTTACCG
2 AGGTCATTTTACCG
3 AGGTCATGTTACCG
4 AGGTCATGTTACCG
5 AGGTCATGTTACCG

Оффлайн I2a1a

  • ...
  • Сообщений: 11074
  • Страна: ee
  • Рейтинг +753/-8
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #24 : 23 Сентябрь 2011, 13:29:44 »
А браузер 1000genomes действительно существует, только трэки Y-элайнментов туда не выведены.

http://browser.1000genomes.org/Homo_sapiens/Location/Overview?db=core;r=Y:8550526-8550526

Оффлайн I2a1a

  • ...
  • Сообщений: 11074
  • Страна: ee
  • Рейтинг +753/-8
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #25 : 23 Сентябрь 2011, 13:35:34 »
Я имел в виду маленький фрагмент элайнмента (выравнивания) окружения снипа дабы убедиться что скажем там где у одних T у других действительно G. Типа:


1 AGGTCATGTTACCG
2 AGGTCATTTTACCG
3 AGGTCATGTTACCG
4 AGGTCATGTTACCG
5 AGGTCATGTTACCG

На FTP проекта есть готовые элайнменты сиквенсов, но я не знаю, есть ли там данные по Y.

Оффлайн Centurion

  • 100% Earth (Solar System) genofond
  • Администратор
  • *****
  • Сообщений: 10121
  • Страна: ru
  • Рейтинг +563/-2
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #26 : 23 Сентябрь 2011, 13:45:45 »
А браузер 1000genomes действительно существует, только трэки Y-элайнментов туда не выведены.

http://browser.1000genomes.org/Homo_sapiens/Location/Overview?db=core;r=Y:8550526-8550526
через экспорт можно получить данные в fasta

Оффлайн I2a1a

  • ...
  • Сообщений: 11074
  • Страна: ee
  • Рейтинг +753/-8
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #27 : 23 Сентябрь 2011, 13:45:56 »
Ув.Юрган, откуда данные? Кто обнаружил эти снипы?
Я предпологаю, что данные в том, виде в каком Вы привели, это не совсем снипы, а фрагменты элайнментов, в которых показаны отличающиеся позиции.

Оффлайн I2a1a

  • ...
  • Сообщений: 11074
  • Страна: ee
  • Рейтинг +753/-8
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #28 : 23 Сентябрь 2011, 13:47:38 »
А браузер 1000genomes действительно существует, только трэки Y-элайнментов туда не выведены.

http://browser.1000genomes.org/Homo_sapiens/Location/Overview?db=core;r=Y:8550526-8550526
через экспорт можно получить данные в fasta

Можно, только это не будет элайнмент, а просто последовательность нуклеотидов одной Y хромосомы. :)
Типа этого
>Y dna:chromosome chromosome:GRCh37:Y:8550526:8550526:1 A 

Оффлайн I2a1a

  • ...
  • Сообщений: 11074
  • Страна: ee
  • Рейтинг +753/-8
Re: Гаплогруппа N в проекте 1000 genomes
« Ответ #29 : 23 Сентябрь 2011, 13:51:16 »
А вот такие структуры из списка VL-снипов вообще не могут считаться снипами.

Цитировать
VL75   Y   4114451      .   CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA   CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
Больше похоже на мини -или микросателлит. :)

 

© 2007 Молекулярная Генеалогия (МолГен)

Внимание! Все сообщения отражают только мнения их авторов.
Все права на материалы принадлежат их авторам (владельцам) и сетевым изданиям, с которых они взяты.


Rambler's Top100