АвторТема: Снипы R1a: ссылки на темы на форуме и на проекты в ФТДНА  (Прочитано 134806 раз)

0 Пользователей и 1 Гость просматривают эту тему.

Оффлайн napobo3

  • Сообщений: 1314
  • Страна: il
  • Рейтинг +338/-2
  • קַח-נָא אֶת-בִּנְךָ אֶת-יְחִידְךָ אֲשֶׁר-אָהַבְתָּ, אֶת-יִצְחָק
  • Y-ДНК: J-FGC5231
  • мтДНК: N1b2
L657 найден у Parasar'a - обладателя L342.2, кит N12617
http://bit.ly/L_342

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • ...
  • Сообщений: 8785
  • Страна: gt
  • Рейтинг +740/-7
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
L657 найден у Parasar'a - обладателя L342.2, кит N12617
http://bit.ly/L_342
Интересно, будет ли он выше или ниже по рангу в сравнении с L342

Оффлайн napobo3

  • Сообщений: 1314
  • Страна: il
  • Рейтинг +338/-2
  • קַח-נָא אֶת-בִּנְךָ אֶת-יְחִידְךָ אֲשֶׁר-אָהַבְתָּ, אֶת-יִצְחָק
  • Y-ДНК: J-FGC5231
  • мтДНК: N1b2
L657 найден у Parasar'a - обладателя L342.2, кит N12617
http://bit.ly/L_342
Интересно, будет ли он выше или ниже по рангу в сравнении с L342
...или приватный...

Оффлайн Valikhan

  • Группа N
  • *
  • Сообщений: 2352
  • Страна: kz
  • Рейтинг +101/-1
  • Ysearch 63CDM. Mitosearch EEVT3
    • Turkic World
  • Y-ДНК: N1c1d1 - L1034 (L1032, L1033)
  • мтДНК: B5a1a
L657 найден у Parasar'a - обладателя L342.2, кит N12617
http://bit.ly/L_342
Интересно, будет ли он выше или ниже по рангу в сравнении с L342
Похоже что ниже по любому.

Цитировать
L657 was found by the primers for P177. The WTY that found L342.2 did test the P177 segment without finding anything, so is probably L657- . This, in turn, would mean that L657 is downstream from R-L342.2.

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • ...
  • Сообщений: 8785
  • Страна: gt
  • Рейтинг +740/-7
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
L657 найден у Parasar'a - обладателя L342.2, кит N12617
http://bit.ly/L_342
Интересно, будет ли он выше или ниже по рангу в сравнении с L342
Похоже что ниже по любому.

Цитировать
L657 was found by the primers for P177. The WTY that found L342.2 did test the P177 segment without finding anything, so is probably L657- . This, in turn, would mean that L657 is downstream from R-L342.2.
Т.е. этот сегмент уже тестировали у того, у кого первого нашли L342?

Оффлайн Naeel

  • Сообщений: 702
  • Страна: ru
  • Рейтинг +50/-2
  • Y-ДНК: R1a1a1b2a2b* L342+ Z94+ L871+ L875+ Z2122+ L657- Z2123- F1345-
  • мтДНК: T2a 16126C 16217C 16294T 16296T 16519C 73G 263G 315.1C
первый 342 - пакистанец, живущий в Америке
Мамлюк, по нашему, по форумному
657 - индус

Оффлайн Valikhan

  • Группа N
  • *
  • Сообщений: 2352
  • Страна: kz
  • Рейтинг +101/-1
  • Ysearch 63CDM. Mitosearch EEVT3
    • Turkic World
  • Y-ДНК: N1c1d1 - L1034 (L1032, L1033)
  • мтДНК: B5a1a
Т.е. этот сегмент уже тестировали у того, у кого первого нашли L342?

Он найден у ZXYT8, parasar на дна-форумз. Он положительный на 342 и 657.
У Мамлюка и Левина 657 негативный.
К сожалению, этот снип не тестировали по WTY у annihilus.

Оффлайн VVR

  • ...
  • Сообщений: 2699
  • Страна: ua
  • Рейтинг +615/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
первый 342 - пакистанец, живущий в Америке
Мамлюк, по нашему, по форумному
657 - индус
Мамлюк не пакистанец, а палестинец, араб.

Оффлайн VVR

  • ...
  • Сообщений: 2699
  • Страна: ua
  • Рейтинг +615/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
У Мамлюка и Левина 657 негативный.

Откуда данные? На WTY не отмечено, что Мамлюка тестировали на 657.

Оффлайн Naeel

  • Сообщений: 702
  • Страна: ru
  • Рейтинг +50/-2
  • Y-ДНК: R1a1a1b2a2b* L342+ Z94+ L871+ L875+ Z2122+ L657- Z2123- F1345-
  • мтДНК: T2a 16126C 16217C 16294T 16296T 16519C 73G 263G 315.1C
первый 342 - пакистанец, живущий в Америке
Мамлюк, по нашему, по форумному
657 - индус
Мамлюк не пакистанец, а палестинец, араб.
ошибся ...
какеи в Иерусалиме пакистанцы ...

Иран, Ирак - какая разница ?  :)

Оффлайн Valikhan

  • Группа N
  • *
  • Сообщений: 2352
  • Страна: kz
  • Рейтинг +101/-1
  • Ysearch 63CDM. Mitosearch EEVT3
    • Turkic World
  • Y-ДНК: N1c1d1 - L1034 (L1032, L1033)
  • мтДНК: B5a1a
У Мамлюка и Левина 657 негативный.

Откуда данные? На WTY не отмечено, что Мамлюка тестировали на 657.

Это предположение, основанное на этом:
Цитировать
657 was found by the primers for P177. The WTY that found L342.2 did test the P177 segment without finding anything, so is probably L657- . This, in turn, would mean that L657 is downstream from R-L342.2.

То есть если Р177 негатив то и 657 тоже негатив.

НБ. Я был не прав насчёт annihilus у него Р177-, то есть L657-. Интересно было бы другие ветки не 342+ проверить на Р177.

Оффлайн VVR

  • ...
  • Сообщений: 2699
  • Страна: ua
  • Рейтинг +615/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Сейчас проверю.

Оффлайн VVR

  • ...
  • Сообщений: 2699
  • Страна: ua
  • Рейтинг +615/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Сейчас проверю.
Предположение странное. У индуса L657+. а Р177-.
Позиция у этих снипов одинаковая.

SNP   Details   Chr   Start   End   Mutation   YCC hg   ISOGG hg   Region   Forward Primer   Reverse Primer
P177        ChrY   12669846   12669846   C to T    E1b   E1b   P177   TGTAAAACGACGGCCAGTGCCTCAGCCTCCCAAAG   CAGGAAACAGCTATGACCTTCCACCAACATTCCTACAG
L657        ChrY   12669864   12669864   G to A   Approx. hg: R-M417   not listed   Found in a hg R-M417 WTY participant   P177_F   P177_R

Оффлайн VVR

  • ...
  • Сообщений: 2699
  • Страна: ua
  • Рейтинг +615/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Ага , понял. В WTY, в SNP-info видимо опечатка. У всех R1a1a1 в этой позиции стоит С. Т.е. должно быть L657 не G to A, а C to A.
Т.е. оба снипа в одной позиции, но Р177+ С мутирует в Т, а L657+ C мутирует в А.
Таким образом, если ранее тестировали Р177-, то значит в этой позиции определяли С.(если бы определили А , то сообщили бы о новом снипе).Значит  у кого было Р177-, а так было у всех R1a1 ранее протестированных в WTY, у того и L657-.

Оффлайн Dudki

  • Сообщений: 607
  • Страна: mn
  • Рейтинг +85/-4
  • Synstkak uli tev arsemast
  • Y-ДНК: R-FGC2555
  • мтДНК: H
Сейчас проверю.
Предположение странное. У индуса L657+. а Р177-.
Позиция у этих снипов одинаковая.

SNP   Details   Chr   Start   End   Mutation   YCC hg   ISOGG hg   Region   Forward Primer   Reverse Primer
P177        ChrY   12669846   12669846   C to T    E1b   E1b   P177   TGTAAAACGACGGCCAGTGCCTCAGCCTCCCAAAG   CAGGAAACAGCTATGACCTTCCACCAACATTCCTACAG
L657        ChrY   12669864   12669864   G to A   Approx. hg: R-M417   not listed   Found in a hg R-M417 WTY participant   P177_F   P177_R
В 23andMe это rs16980473, показан вариант только С - Т

 

© 2007 Молекулярная Генеалогия (МолГен)

Внимание! Все сообщения отражают только мнения их авторов.
Все права на материалы принадлежат их авторам (владельцам) и сетевым изданиям, с которых они взяты.


Rambler's Top100