АвторТема: Снипы R1a: ссылки на темы на форуме и на проекты в ФТДНА  (Прочитано 135911 раз)

0 Пользователей и 1 Гость просматривают эту тему.

Оффлайн Аббат Бузони

  • ...
  • Сообщений: 19425
  • Страна: ru
  • Рейтинг +1541/-57
  • Y-ДНК: I1a2a1a3a1a1a-YP1084+
  • мтДНК: H16
Сейчас проверю.
Предположение странное. У индуса L657+. а Р177-.
Позиция у этих снипов одинаковая.

SNP   Details   Chr   Start   End   Mutation   YCC hg   ISOGG hg   Region   Forward Primer   Reverse Primer
P177        ChrY   12669846   12669846   C to T    E1b   E1b   P177   TGTAAAACGACGGCCAGTGCCTCAGCCTCCCAAAG   CAGGAAACAGCTATGACCTTCCACCAACATTCCTACAG
L657        ChrY   12669864   12669864   G to A   Approx. hg: R-M417   not listed   Found in a hg R-M417 WTY participant   P177_F   P177_R
В 23andMe это rs16980473, показан вариант только С - Т

У моих везде С.

Оффлайн Аббат Бузони

  • ...
  • Сообщений: 19425
  • Страна: ru
  • Рейтинг +1541/-57
  • Y-ДНК: I1a2a1a3a1a1a-YP1084+
  • мтДНК: H16

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • ...
  • Сообщений: 8772
  • Страна: gt
  • Рейтинг +742/-7
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Да, мы уже в курсе.
У британской ветви выявили L664.
« Последнее редактирование: 17 Август 2011, 19:11:32 от Centurion »

Оффлайн VVR

  • ...
  • Сообщений: 2690
  • Страна: ua
  • Рейтинг +615/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Да, мы уже в курсе.
У британской ветви выявили L664.
Это у ирландца О'Нила(DYS388=10)?
Откуда информация. На WTY пока ничего не отмечено.
Только видно, что из R1a1a1 О'Нил и Павеллек(Польша-Пруссия) ближе всего к результатам.

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • ...
  • Сообщений: 8772
  • Страна: gt
  • Рейтинг +742/-7
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Да, мы уже в курсе.
У британской ветви выявили L664.
Это у ирландца О'Нила(DYS388=10)?
Откуда информация. На WTY пока ничего не отмечено.
Только видно, что из R1a1a1 О'Нил и Павеллек(Польша-Пруссия) ближе всего к результатам.
Да, вроде. Информацию надо бы проверить, а я ничего про этот снип не нашел.
« Последнее редактирование: 18 Август 2011, 15:33:47 от Yurgan »

Оффлайн VVR

  • ...
  • Сообщений: 2690
  • Страна: ua
  • Рейтинг +615/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Информация на WTYпоявилась
О'Нил(DYS388=10)-L664
Павеллек(R1a1a1i)-L669,L670

Оффлайн Людмила

  • Сообщений: 1051
  • Рейтинг +148/-1
Цитировать
Павеллек(R1a1a1i)-L669,L670
Это же "прус"?  Что могут означать эти SNP - частные или общие?

Оффлайн LeslaАвтор темы

  • Главный модератор
  • *****
  • Сообщений: 9142
  • Страна: ru
  • Рейтинг +2327/-9
  • FTDNA: 154400 (Big Y - 283049)
  • Y-ДНК: R1a-YP682 (VK01/VK03+)
Цитировать
Павеллек(R1a1a1i)-L669,L670
Это же "прус"?  Что могут означать эти SNP - частные или общие?
Это когда появятся в заказах ФТДНА и люди начнут тестировать, то и выяснится точнее.

Оффлайн LeslaАвтор темы

  • Главный модератор
  • *****
  • Сообщений: 9142
  • Страна: ru
  • Рейтинг +2327/-9
  • FTDNA: 154400 (Big Y - 283049)
  • Y-ДНК: R1a-YP682 (VK01/VK03+)
Цитировать
Павеллек(R1a1a1i)-L669,L670
Это же "прус"?  Что могут означать эти SNP - частные или общие?
Это когда появятся в заказах ФТДНА и люди начнут тестировать, то и выяснится точнее.
Ну вот и появилась возможность заказать в ФТДНА снипы L669, L670.
А также новые снипы L657 и Z93, и L664.

Оффлайн Людмила

  • Сообщений: 1051
  • Рейтинг +148/-1
Цитировать
Ну вот и появилась возможность заказать в ФТДНА снипы L669, L670.
Из разных форумов поняла, что мы, скорей всего L669-, L670-.

Оффлайн Semargl

  • "El sueño de la razón produce monstruos" ©
  • Модератор
  • *****
  • Сообщений: 5478
  • Страна: hr
  • Рейтинг +2865/-5
  • www.semargl.me
    • www.semargl.me
  • Y-ДНК: R1a [CTS3402+]
  • мтДНК: U4a2g
Ну вот и появилась возможность заказать в ФТДНА снипы ... Z93 ... .
+1 за информацию.
Уважаемые знатоки, насколько вы оцениваете вероятность положительного снипа z93  у "сарматов"?
Судя по всему, т.к. многие относят "сарматов" к восточным ветвям R1a, и по относительной близости к ашкенази и арабским r1a, z93 у нас может быть положительный.
Вопрос по Шекспиру: "заказать или не заказать"?

Оффлайн Аббат Бузони

  • ...
  • Сообщений: 19425
  • Страна: ru
  • Рейтинг +1541/-57
  • Y-ДНК: I1a2a1a3a1a1a-YP1084+
  • мтДНК: H16
Заказать. Даже если будет "-", все равно хорошо, будет статистика по снипу.

Оффлайн LeslaАвтор темы

  • Главный модератор
  • *****
  • Сообщений: 9142
  • Страна: ru
  • Рейтинг +2327/-9
  • FTDNA: 154400 (Big Y - 283049)
  • Y-ДНК: R1a-YP682 (VK01/VK03+)
Заказать. Даже если будет "-", все равно хорошо, будет статистика по снипу.
Поддерживаю Аббат Бузони и мой плюс Тунцу за интерес к новым снипом :)
Под лежачий камень вода не течет. Если не испытывать новые перспективные снипы, то так ни в чем и не разберемся. Отрицательный результат имеет не меньшую ценность.

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • ...
  • Сообщений: 8772
  • Страна: gt
  • Рейтинг +742/-7
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Цитировать
Павеллек(R1a1a1i)-L669,L670
Это же "прус"?  Что могут означать эти SNP - частные или общие?
Это когда появятся в заказах ФТДНА и люди начнут тестировать, то и выяснится точнее.
Ну вот и появилась возможность заказать в ФТДНА снипы L669, L670.
А также новые снипы L657 и Z93, и L664.
Z93 - предковый по отношению к L342.2?


Оффлайн Аббат Бузони

  • ...
  • Сообщений: 19425
  • Страна: ru
  • Рейтинг +1541/-57
  • Y-ДНК: I1a2a1a3a1a1a-YP1084+
  • мтДНК: H16

 

© 2007 Молекулярная Генеалогия (МолГен)

Внимание! Все сообщения отражают только мнения их авторов.
Все права на материалы принадлежат их авторам (владельцам) и сетевым изданиям, с которых они взяты.


Rambler's Top100