АвторТема: Снипы R1a  (Прочитано 124282 раз)

0 Пользователей и 1 Гость просматривают эту тему.

Оффлайн VVR

  • ...
  • Сообщений: 2723
  • Страна: ua
  • Рейтинг +615/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Re: Снипы R1a
« Ответ #45 : 11 Август 2011, 15:13:15 »
первый 342 - пакистанец, живущий в Америке
Мамлюк, по нашему, по форумному
657 - индус
Мамлюк не пакистанец, а палестинец, араб.

Оффлайн VVR

  • ...
  • Сообщений: 2723
  • Страна: ua
  • Рейтинг +615/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Re: Снипы R1a
« Ответ #46 : 11 Август 2011, 15:23:40 »
У Мамлюка и Левина 657 негативный.

Откуда данные? На WTY не отмечено, что Мамлюка тестировали на 657.

Оффлайн Naeel

  • Сообщений: 714
  • Страна: ru
  • Рейтинг +50/-2
  • Y-ДНК: R1a1a1b2a2b* L342+ Z94+ L871+ L875+ Z2122+ L657- Z2123- F1345-
  • мтДНК: T2a 16126C 16217C 16294T 16296T 16519C 73G 263G 315.1C
Re: Снипы R1a
« Ответ #47 : 11 Август 2011, 15:53:12 »
первый 342 - пакистанец, живущий в Америке
Мамлюк, по нашему, по форумному
657 - индус
Мамлюк не пакистанец, а палестинец, араб.
ошибся ...
какеи в Иерусалиме пакистанцы ...

Иран, Ирак - какая разница ?  :)

Оффлайн Valikhan

  • Группа N
  • *
  • Сообщений: 2371
  • Страна: kz
  • Рейтинг +101/-1
  • Ysearch 63CDM. Mitosearch EEVT3
    • Turkic World
  • Y-ДНК: N1c1d1 - L1034 (L1032, L1033)
  • мтДНК: B5a1a
Re: Снипы R1a
« Ответ #48 : 11 Август 2011, 19:36:23 »
У Мамлюка и Левина 657 негативный.

Откуда данные? На WTY не отмечено, что Мамлюка тестировали на 657.

Это предположение, основанное на этом:
Цитировать
657 was found by the primers for P177. The WTY that found L342.2 did test the P177 segment without finding anything, so is probably L657- . This, in turn, would mean that L657 is downstream from R-L342.2.

То есть если Р177 негатив то и 657 тоже негатив.

НБ. Я был не прав насчёт annihilus у него Р177-, то есть L657-. Интересно было бы другие ветки не 342+ проверить на Р177.

Оффлайн VVR

  • ...
  • Сообщений: 2723
  • Страна: ua
  • Рейтинг +615/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Re: Снипы R1a
« Ответ #49 : 11 Август 2011, 19:43:01 »
Сейчас проверю.

Оффлайн VVR

  • ...
  • Сообщений: 2723
  • Страна: ua
  • Рейтинг +615/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Re: Снипы R1a
« Ответ #50 : 11 Август 2011, 20:23:10 »
Сейчас проверю.
Предположение странное. У индуса L657+. а Р177-.
Позиция у этих снипов одинаковая.

SNP   Details   Chr   Start   End   Mutation   YCC hg   ISOGG hg   Region   Forward Primer   Reverse Primer
P177        ChrY   12669846   12669846   C to T    E1b   E1b   P177   TGTAAAACGACGGCCAGTGCCTCAGCCTCCCAAAG   CAGGAAACAGCTATGACCTTCCACCAACATTCCTACAG
L657        ChrY   12669864   12669864   G to A   Approx. hg: R-M417   not listed   Found in a hg R-M417 WTY participant   P177_F   P177_R

Оффлайн VVR

  • ...
  • Сообщений: 2723
  • Страна: ua
  • Рейтинг +615/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Re: Снипы R1a
« Ответ #51 : 11 Август 2011, 20:40:35 »
Ага , понял. В WTY, в SNP-info видимо опечатка. У всех R1a1a1 в этой позиции стоит С. Т.е. должно быть L657 не G to A, а C to A.
Т.е. оба снипа в одной позиции, но Р177+ С мутирует в Т, а L657+ C мутирует в А.
Таким образом, если ранее тестировали Р177-, то значит в этой позиции определяли С.(если бы определили А , то сообщили бы о новом снипе).Значит  у кого было Р177-, а так было у всех R1a1 ранее протестированных в WTY, у того и L657-.

Оффлайн Dudki

  • Сообщений: 596
  • Страна: mn
  • Рейтинг +79/-4
  • Synstkak uli tev arsemast
  • Y-ДНК: R-FGC2555
  • мтДНК: H
Re: Снипы R1a
« Ответ #52 : 11 Август 2011, 21:51:39 »
Сейчас проверю.
Предположение странное. У индуса L657+. а Р177-.
Позиция у этих снипов одинаковая.

SNP   Details   Chr   Start   End   Mutation   YCC hg   ISOGG hg   Region   Forward Primer   Reverse Primer
P177        ChrY   12669846   12669846   C to T    E1b   E1b   P177   TGTAAAACGACGGCCAGTGCCTCAGCCTCCCAAAG   CAGGAAACAGCTATGACCTTCCACCAACATTCCTACAG
L657        ChrY   12669864   12669864   G to A   Approx. hg: R-M417   not listed   Found in a hg R-M417 WTY participant   P177_F   P177_R
В 23andMe это rs16980473, показан вариант только С - Т

Оффлайн Аббат Бузони

  • ...
  • Сообщений: 19613
  • Страна: ru
  • Рейтинг +1483/-56
  • Y-ДНК: I1a2a1a3a1a1a-YP1084+
  • мтДНК: H16
Re: Снипы R1a
« Ответ #53 : 11 Август 2011, 22:24:29 »
Сейчас проверю.
Предположение странное. У индуса L657+. а Р177-.
Позиция у этих снипов одинаковая.

SNP   Details   Chr   Start   End   Mutation   YCC hg   ISOGG hg   Region   Forward Primer   Reverse Primer
P177        ChrY   12669846   12669846   C to T    E1b   E1b   P177   TGTAAAACGACGGCCAGTGCCTCAGCCTCCCAAAG   CAGGAAACAGCTATGACCTTCCACCAACATTCCTACAG
L657        ChrY   12669864   12669864   G to A   Approx. hg: R-M417   not listed   Found in a hg R-M417 WTY participant   P177_F   P177_R
В 23andMe это rs16980473, показан вариант только С - Т

У моих везде С.

Оффлайн Аббат Бузони

  • ...
  • Сообщений: 19613
  • Страна: ru
  • Рейтинг +1483/-56
  • Y-ДНК: I1a2a1a3a1a1a-YP1084+
  • мтДНК: H16
Re: Снипы R1a
« Ответ #54 : 17 Август 2011, 18:19:54 »

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • ...
  • Сообщений: 8728
  • Страна: gt
  • Рейтинг +673/-6
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Снипы R1a
« Ответ #55 : 17 Август 2011, 18:42:31 »
Да, мы уже в курсе.
У британской ветви выявили L664.
« Последнее редактирование: 17 Август 2011, 19:11:32 от Centurion »

Оффлайн VVR

  • ...
  • Сообщений: 2723
  • Страна: ua
  • Рейтинг +615/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Re: Снипы R1a
« Ответ #56 : 17 Август 2011, 19:48:00 »
Да, мы уже в курсе.
У британской ветви выявили L664.
Это у ирландца О'Нила(DYS388=10)?
Откуда информация. На WTY пока ничего не отмечено.
Только видно, что из R1a1a1 О'Нил и Павеллек(Польша-Пруссия) ближе всего к результатам.

Оффлайн Yurgan

  • Кто везёт, тому везёт
  • ...
  • Сообщений: 8728
  • Страна: gt
  • Рейтинг +673/-6
  • Потомок кузнеца Ильмаринена
    • Сибирский родословец
Re: Снипы R1a
« Ответ #57 : 18 Август 2011, 14:53:00 »
Да, мы уже в курсе.
У британской ветви выявили L664.
Это у ирландца О'Нила(DYS388=10)?
Откуда информация. На WTY пока ничего не отмечено.
Только видно, что из R1a1a1 О'Нил и Павеллек(Польша-Пруссия) ближе всего к результатам.
Да, вроде. Информацию надо бы проверить, а я ничего про этот снип не нашел.
« Последнее редактирование: 18 Август 2011, 15:33:47 от Yurgan »

Оффлайн VVR

  • ...
  • Сообщений: 2723
  • Страна: ua
  • Рейтинг +615/-0
  • Y-ДНК: o.R1a1a1b1a2a1a1a1e~-YP569,YP1260+;м.R1a1a1b1a1a1a2~-L260,YP1337+
  • мтДНК: K1c1h
Re: Снипы R1a
« Ответ #58 : 19 Август 2011, 15:01:04 »
Информация на WTYпоявилась
О'Нил(DYS388=10)-L664
Павеллек(R1a1a1i)-L669,L670

Оффлайн Людмила

  • Сообщений: 1048
  • Рейтинг +142/-1
Re: Снипы R1a
« Ответ #59 : 19 Август 2011, 23:05:57 »
Цитировать
Павеллек(R1a1a1i)-L669,L670
Это же "прус"?  Что могут означать эти SNP - частные или общие?

 

© 2007 Молекулярная Генеалогия (МолГен)

Внимание! Все сообщения отражают только мнения их авторов.
Все права на материалы принадлежат их авторам (владельцам) и сетевым изданиям, с которых они взяты.


Rambler's Top100