АвторТема: Модальные гаплотипы, снип-мутации, номенклатуры субкладов и филогенетическое древо I2  (Прочитано 23165 раз)

0 Пользователей и 1 Гость просматривают эту тему.

Оффлайн Ulysses

  • Сообщений: 112
  • Страна: 00
  • Рейтинг +22/-0
Re: Новая номенклатура субкладов I2a: июль 2009
« Ответ #15 : 17 Июль 2009, 11:05:18 »
В статье Кена Нордведта на дереве гаплогруппы I есть I2a2a-Dinaric. Что-то я запутался... Просто, если мне с моей южнодинарской I2a делать deep clade test - какие примерно результаты можно ожидать ?

Оффлайн Аббат Бузони

  • ...
  • Сообщений: 19613
  • Страна: ru
  • Рейтинг +1483/-56
  • Y-ДНК: I1a2a1a3a1a1a-YP1084+
  • мтДНК: H16
Re: Новая номенклатура субкладов I2a: июль 2009
« Ответ #16 : 17 Июль 2009, 11:50:54 »
Напишите в фтдна и спросите какие снипы они будут проверять, обычно они обзначают исследуемые снипы на "дереве" в профайле.

Оффлайн zastrug

  • ...
  • Сообщений: 10300
  • Страна: tt
  • Рейтинг +1730/-45
  • I2b1c (P78+)=I2a2a1b1a
  • Y-ДНК: I2b1c
  • мтДНК: T2a1a
Re: Новая номенклатура субкладов I2a: июль 2009
« Ответ #17 : 17 Июль 2009, 12:24:05 »
На форуме Нордведт так пояснил ситуацию по I2a2a. Даю без перевода, боюсь упустить нюансы:
"A relatively new clade of M423 called Disles just received its first test result on S163 a.k.a. L69. Ethnoancestry found the Disles haplotype "T" on this nervous snp, uniting Disles with Dinaric as the haplotype motifs suggested. Disles gets its membership almost entirely from Scotland. So it will have an interesting post-LGM migratory history in Europe when we sort it out.
S163 a.k.a. L69 is a useful snp to divide I2a2-Isles from I2a2a Dinaric and Disles if you want this distinction pinned down by snp."
Но это он про I2a2а по своей номенклатуре. I2a2a по ISOGG у него  I2a2a1- all of I2a2a and M359=P41.2

Оффлайн I2a1aАвтор темы

  • Модератор
  • *****
  • Сообщений: 10999
  • Страна: ee
  • Рейтинг +755/-8
Re: Новая номенклатура субкладов I2a: июль 2009
« Ответ #18 : 02 Октябрь 2009, 19:20:35 »

Оффлайн I2a1aАвтор темы

  • Модератор
  • *****
  • Сообщений: 10999
  • Страна: ee
  • Рейтинг +755/-8
Re: Новая номенклатура субкладов I2a: июль 2009
« Ответ #19 : 02 Октябрь 2009, 19:21:44 »
Цитата: Аббат Бузони 28.12.2008, 20:36
Частоты гаплогруппы I2

http://www.radikal.ru
http://www.radikal.ru

http://genofond.ru/default2.aspx?s=0&p=355

Оффлайн I2a1aАвтор темы

  • Модератор
  • *****
  • Сообщений: 10999
  • Страна: ee
  • Рейтинг +755/-8
Re: Новая номенклатура субкладов I2a: июль 2009
« Ответ #20 : 02 Октябрь 2009, 19:27:08 »
Цитата: Vadim Verenich 2.4.2009, 23:11
Древо кладов по различным источникам и обнаруженные SNP мутации.



http://knordtvedt.home.bresnan.net/WarpedFounderTree.ppt
http://knordtvedt.home.bresnan.net/SNPTree-I.ppt

Оффлайн I2a1aАвтор темы

  • Модератор
  • *****
  • Сообщений: 10999
  • Страна: ee
  • Рейтинг +755/-8
Re: Новая номенклатура субкладов I2a: июль 2009
« Ответ #21 : 07 Октябрь 2009, 03:25:08 »
В статье Кена Нордведта на дереве гаплогруппы I есть I2a2a-Dinaric. Что-то я запутался... Просто, если мне с моей южнодинарской I2a делать deep clade test - какие примерно результаты можно ожидать ?

Кен Нордтведт использует несколько иное обозначение кладов, частo обозначения кладов I2a2 и I2a1 существенно меняют местами. Поэтому в первую очередь нужно обращать внимание на снип-мутацию.

Оффлайн I2a1aАвтор темы

  • Модератор
  • *****
  • Сообщений: 10999
  • Страна: ee
  • Рейтинг +755/-8
Вот например описание снипа M423. В древе YCC (Y Chromosome Consortium) гаплогруппа описываемая этим снипом называется I2a2, в номенклатуре ISOGG - гаплогруппой I2a1.
А вот - "родительская" снип-мутация P37, (схематическое изображение ее положения на Y-chromosome)

Оффлайн I2a1aАвтор темы

  • Модератор
  • *****
  • Сообщений: 10999
  • Страна: ee
  • Рейтинг +755/-8
До недавнего времени SNP мутация L.69( 23andMe=rs9786274) (Ethoancetry=S163) считалась надежным фактором для разделения субкладов I2a2-Isles и I2a2-Dinaric, так как предыдущая статистика показала, что  из  6 тестов представителей субклады I2a2-Isles 6 показали результат "G" (L69+), из 7 тестов представителей субклады I2a2-Dinaric и Disles все 7 показали "T" (L69-).
Однако 14.10.2009 г. в отчете FTDNA о результататах тестирования SNP L69 сообщается о позитивном результате теста на SNP L69 представителя южного динарского субклада I2a2-M423-Dinaric-S, предки которого жили в Боснии & Герцеговины.
В связи с этим проясняется позиция доктора Крахна (см. топологию чернового древа гаплогруппы I), согласно которой L69.2 (встречается внутри субклада маркированного P41.2=M359.2) и L69.3 (в "сестринских ветвях" P41.2) не рекомендуются для использования в филогенетическом древе
« Последнее редактирование: 14 Октябрь 2009, 19:39:06 от Vadim Verenich »

Оффлайн I2a1aАвтор темы

  • Модератор
  • *****
  • Сообщений: 10999
  • Страна: ee
  • Рейтинг +755/-8

Оффлайн I2a1aАвтор темы

  • Модератор
  • *****
  • Сообщений: 10999
  • Страна: ee
  • Рейтинг +755/-8
До недавнего времени SNP мутация L.69( 23andMe=rs9786274) (Ethoancetry=S163) считалась надежным фактором для разделения субкладов I2a2-Isles и I2a2-Dinaric, так как предыдущая статистика показала, что  из  6 тестов представителей субклады I2a2-Isles 6 показали результат "G" (L69+), из 7 тестов представителей субклады I2a2-Dinaric и Disles все 7 показали "T" (L69-).
Однако 14.10.2009 г. в отчете FTDNA о результататах тестирования SNP L69 сообщается о позитивном результате теста на SNP L69 представителя южного динарского субклада I2a2-M423-Dinaric-S, предки которого жили в Боснии & Герцеговины.
В связи с этим проясняется позиция доктора Крахна (см. топологию чернового древа гаплогруппы I), согласно которой L69.2 (встречается внутри субклада маркированного P41.2=M359.2) и L69.3 (в "сестринских ветвях" P41.2) не рекомендуются для использования в филогенетическом древе

Два варианта SNP-мутации -L69.2 (cубклад I2a2a) и L69.3 (субклад I2a2b) -включены в состав драфта нового гаплогруппного дерева ISOGG. Расположение снип-мутации в игрек-хромосоме здесь и  параметры:

ame:      L69
Type:     snp
Description:     
Source:     other
Position:     ChrY:14320356..14320356 (+ strand)
Length:     1
ISOGG_haplogroup:     IJK and I2a2b
Mutation:     G to T
YCC_haplogroup:     not listed
allele_anc:     G
allele_der:     T
comments:     Recurrent
      Dinucleotiderepeat
primer_f:     AAATTTGGGTCCACTAAAAGTGAGAATCT
primer_r:     CAGGTCGCTGAGAGGGGCTGGTCAC

Браузер игрек хромосомы
http://ymap.ftdna.com/cgi-bin/gbrowse/hs_chrY/?name=ChrY%3A14320356..14320356
Драфт дерева гаплогрупп
http://ytree.ftdna.com/index.php?name=Draft&parent=root

Заслуживает внимания тот факт, что снип-мутация L69 встречается в 4 вариантах, 2 типологически близких описывают клад I2a2b-L69.2 и часть I2a2-L69.3. Четвертый вариант той же снип-мутации характеризует одну из ветвей  R1b1b2a1b-P312.
Иными словами, SNP-мутация L69 -крайне неустойчива в филогенетическом плане.
Дополнительная информация:
http://forum.molgen.org/index.php/topic,115.msg18441.html#msg18441
 

Оффлайн I2a1aАвтор темы

  • Модератор
  • *****
  • Сообщений: 10999
  • Страна: ee
  • Рейтинг +755/-8
Возвращаясь к L69.2

Вот так определяет мой субклад 23andme (первая позиция предковое состояние, вторая -состояние после мутации)

I2a2b defining mutations
rs9786274 (L69.2)     G         T
 
I2a2 defining mutations
i4000125 (M423)     G         A
 
I2a defining mutations
i4000184 (P37.2)     T         C
 
I2 defining mutations
rs17307294 (M438)     A         G
rs35547782 (L68)     C         T
 
I defining mutations
i4000163 (P212)     T         A
rs2032597 (M170)     A         C
rs2319818 (U179)     G         A
rs9341301 (M258)     T         C
 
I/J defining mutations
rs17250163 (P126)     C         G
rs17250887 (P130)     A         T
rs17306671 (M429)     T         A
rs17306699 (P129)     A         G
rs17315772 (P124)     A         C
rs17315821 (P123)     T         C
rs7892893 (P127)     C         T
 
I/J/K defining mutations
rs9786139 (L15)     A         G
rs9786714 (L16)     G         A
 
F defining mutations
i4000053 (P14)     D         I
rs16980391 (P149)     G         A
rs16980396 (P148)     C         T
rs16980459 (P139)     G         A
rs16980478 (P138)     T         C
rs16980499 (P166)     C         T
rs16980711 (P133)     G         A
rs16981340 (P146)     C         T
rs17174528 (P187)     G         T
rs17842387 (P145)     G         A
rs2032652 (M89)     C         T
rs2032665 (M213)     T         C
rs4589047 (P163)     A         T
rs4988808 (P142)     G         A
rs7067496 (M235)     T         G
rs9306845 (P141)     G         A
rs9306848 (P160)     A         C
rs9785905 (P159)     C         A
rs9785908 (P136)     T         G
rs9785913 (P158)     C         T
rs9786095 (P157)     T         C
rs9786502 (P135)     C         T
rs9786636 (P140)     G         C
rs9786707 (P151)     T         C
rs9786877 (P134)     C         G
 
C/F defining mutations
rs4141886 (P143)     G         A
 
C/T defining mutations
i4000227 (P9.1)     C         A
rs2032595 (M168)     C         T
rs9341317 (M294)     C         T
 
B/T defining mutations
i4000077 (M139)     I         D
rs13447347 (M299)     T         G
rs2032630 (M42)     A         T
rs2032647 (M94)     C         A

Оффлайн Centurion

  • 100% Earth (Solar System) genofond
  • Администратор
  • *****
  • Сообщений: 10074
  • Страна: ru
  • Рейтинг +567/-2
Вадим, это ты сам сделал такую таблицу, или она была на твоей стр 23ия?

Оффлайн I2a1aАвтор темы

  • Модератор
  • *****
  • Сообщений: 10999
  • Страна: ee
  • Рейтинг +755/-8
Кому интересно -результаты анализа снипов в программе Promethease (SNP-pedia) (я использовал только снипы из игрека).
См. приложенный файл
« Последнее редактирование: 27 Октябрь 2009, 01:08:56 от Vadim Verenich »

Оффлайн Овод

  • Главный модератор
  • *****
  • Сообщений: 2158
  • Рейтинг +390/-3
  • Omnia mea mecum porto
  • Y-ДНК: R1a-M198
  • мтДНК: U4a
Вадим, а никаких "параллельных" мутаций (характерных для других гаплогрупп) у Вас не обнаружили? Или - просто не написали о них и надо проверять самому, сравнивая себя с другими?

 

© 2007 Молекулярная Генеалогия (МолГен)

Внимание! Все сообщения отражают только мнения их авторов.
Все права на материалы принадлежат их авторам (владельцам) и сетевым изданиям, с которых они взяты.


Rambler's Top100