АвторТема: Филогенетическое дерево митогаплогруппы H  (Прочитано 15917 раз)

0 Пользователей и 1 Гость просматривают эту тему.

Оффлайн I2a1aАвтор темы

  • ...
  • Сообщений: 10999
  • Страна: ee
  • Рейтинг +755/-8
Уступая просьбам детей Елены, решил попробывать построить в Мурке фрагмент их филогенетического дерева. Для пробы ограничился всего 13 FGS (включая FGS Mitch_Glitch и Anode), хотя BLAST поиск по ближайщим сиквенсов выдает почти 100 FGS митогаплогруппы H.
Поскольку таксономия группы сложная, я ограничился лишь корневым уровнем.

Вот что получается. Видимо, из-за неполной предcтавленности всех ветвей H, возраст всего дерева вместо ожидаемых 28 000 -30 000 лет составил максимум 23 500. Зато возраст H10 (куда попал сиквенс Анода, обозначен мною как H10b, по существующей таксономии это H10a1) - гораздо правдоподобнее, примерно 10 000-15 000 лет. Кстати, Василий обратите внимание на мутацию в rs10238 T>C. Она отделяет Вас от остальных H10a, видимо Ваш субклад будет что-то вроде H10a2.

Сиквенс Митча наиболее "расcнипован", но нет сиквенсов H6 более высокого уровня, поэтому  возраст его ответвления вычислить сейчас невозможно. Надо искать такие FGS в Генбанке.

« Последнее редактирование: 06 Апрель 2010, 00:56:20 от Vadim Verenich »

Оффлайн I2a1aАвтор темы

  • ...
  • Сообщений: 10999
  • Страна: ee
  • Рейтинг +755/-8
Re: Филогенетическое дерево митогаплогруппы H
« Ответ #1 : 06 Апрель 2010, 01:52:06 »
То же с добавлением бабушки napobo3a.

Сразу отмечу, что у Вас все таки неполное совпадение (хотя Мич утверждал обратное) -есть одна мутация в 5302 T>C.
Причем Murka определила митосиквенс бабушки napobo3 в предковый узел по отношению к митосиквенсу Митча. Зато благодаря этому мы можем вычислит примерное время ответвления гаплотипа Мича H6a1a от гаплотипа бабушки napobo3. Оно составляет диапазон от 2 500 +- 2 500 (то есть от5 000 лет до 0, c медианным значением в 2 500 лет).

Круто.-
« Последнее редактирование: 06 Апрель 2010, 02:00:51 от Vadim Verenich »

Оффлайн Anode

  • Группа N
  • *
  • Сообщений: 1500
  • Страна: ca
  • Рейтинг +145/-0
  • PS1 -> TT1 -> EE1 -> PS2
  • Y-ДНК: N1c1
  • мтДНК: H10a1, U5b1
Re: Филогенетическое дерево митогаплогруппы H
« Ответ #2 : 06 Апрель 2010, 01:59:41 »
Ещё раз большущее спасибо.
Очень интересно.
Надеюсь, подтянутся и другие протестированные H10 и запостят в GenBank.

Оффлайн I2a1aАвтор темы

  • ...
  • Сообщений: 10999
  • Страна: ee
  • Рейтинг +755/-8
Re: Филогенетическое дерево митогаплогруппы H
« Ответ #3 : 06 Апрель 2010, 02:15:35 »
И еще. Я был бы признателен если бы кто-то подготовил выборку из митосиквенсов H, которые по результатам прогонки BLAST поиска в Генбанке показали самые высокие очки по выравниванию.

Все эти сиквенсы можно скачать в формате FASTA (включая header) и засунуть в один файл. Тогда я бы мог построить более полное и точное дерево H. Но лучше всего было бы вытащить все митосиквенсы H из Генбанка.

gb|EF491002.1|  Homo sapiens haplotype H10 mitochondrion, comp...  3.058e+04  0.0 
gb|AY738970.1|  Homo sapiens isolate Tor31(ZE1584) mitochondri...  3.058e+04  0.0 
gb|AY495101.1|  Homo sapiens isolate H1-12 mitochondrion, comp...  3.058e+04  0.0 
gb|EU073971.1|  Homo sapiens haplotype H10 mitochondrion, comp...  3.057e+04  0.0 
gb|FJ999540.1|  Homo sapiens haplogroup H* mitochondrion, comp...  3.057e+04  0.0 
gb|EF556189.1|  Homo sapiens isolate 5314 mitochondrion, compl...  3.057e+04  0.0 
gb|AY739001.1|  Homo sapiens isolate Tor62(ZE348) mitochondrio...  3.057e+04  0.0 
gb|AY738987.1|  Homo sapiens isolate Tor48(#97) mitochondrion,...  3.057e+04  0.0 
gb|AY738976.1|  Homo sapiens isolate Tor37(ZE672) mitochondrio...  3.057e+04  0.0 
gb|AY339403.1|  Homo sapiens isolate F2 (PO64) mitochondrion, ...  3.057e+04  0.0 
gb|AY339402.1|  Homo sapiens isolate F1 (PO62) mitochondrion, ...  3.057e+04  0.0 
gb|AY495117.1|  Homo sapiens isolate H1-28 mitochondrion, comp...  3.057e+04  0.0 
gb|AY495114.1|  Homo sapiens isolate H1-25 mitochondrion, comp...  3.057e+04  0.0 
gb|GU569076.1|  Homo sapiens haplogroup H10 mitochondrion, com...  3.056e+04  0.0 
gb|FJ460532.1|  Homo sapiens isolate TC13 mitochondrion, compl...  3.056e+04  0.0 
gb|EU151553.1|  Homo sapiens haplotype H7* mitochondrion, comp...  3.056e+04  0.0 
gb|EU007846.1|  Homo sapiens isolate 140 mitochondrion, comple...  3.056e+04  0.0 
gb|AY495145.2|  Homo sapiens isolate H2-25 mitochondrion, comp...  3.056e+04  0.0 
gb|AY495120.1|  Homo sapiens isolate H1-31 mitochondrion, comp...  3.056e+04  0.0 
gb|AY495097.1|  Homo sapiens isolate H1-08 mitochondrion, comp...  3.056e+04  0.0 
gb|AY495092.1|  Homo sapiens isolate H1-03 mitochondrion, comp...  3.056e+04  0.0 
gb|AY495091.1|  Homo sapiens isolate H1-02 mitochondrion, comp...  3.056e+04  0.0 
gb|AY495090.1|  Homo sapiens isolate H1-01 mitochondrion, comp...  3.056e+04  0.0 
gb|GQ369957.1|  Homo sapiens isolate MB3027 mitochondrion, com...  3.056e+04  0.0 
gb|GQ478575.1|  Homo sapiens haplogroup H1s mitochondrion, com...  3.056e+04  0.0 
gb|FJ985851.1|  Homo sapiens haplogroup H* mitochondrion, comp...  3.056e+04  0.0 
gb|FJ348221.1|  Homo sapiens isolate ST051 mitochondrion, comp...  3.056e+04  0.0 
gb|DQ523652.1|  Homo sapiens isolate 00120U mitochondrion, com...  3.056e+04  0.0 
gb|DQ523622.1|  Homo sapiens isolate 0009P mitochondrion, comp...  3.056e+04  0.0 
gb|AY738992.1|  Homo sapiens isolate Tor53(#114) mitochondrion...  3.056e+04  0.0 
gb|AY495151.1|  Homo sapiens isolate H3-06 mitochondrion, comp...  3.056e+04  0.0 
gb|GU997629.1|  Homo sapiens haplogroup H3 mitochondrion, comp...  3.056e+04  0.0 
gb|GU812901.1|  Homo sapiens haplogroup H mitochondrion, compl...  3.056e+04  0.0 
gb|GQ304745.1|  Homo sapiens isolate VS (Tor544) mitochondrion...  3.056e+04  0.0 
gb|GQ272387.1|  Homo sapiens haplogroup H16 mitochondrion, com...  3.056e+04  0.0 
gb|EU915474.1|  Homo sapiens isolate ND1/H* (Tor90) mitochondr...  3.056e+04  0.0 
gb|FJ348195.1|  Homo sapiens isolate ST025 mitochondrion, comp...  3.056e+04  0.0 
gb|EU744541.2|  Homo sapiens haplotype H* mitochondrion, compl...  3.056e+04  0.0 
gb|EU600342.1|  Homo sapiens isolate Druze=76 mitochondrion, c...  3.056e+04  0.0 
gb|EF556184.1|  Homo sapiens isolate 4953 mitochondrion, compl...  3.056e+04  0.0 
gb|EU369376.1|  Homo sapiens haplotype H1 mitochondrion, compl...  3.056e+04  0.0 
gb|EU148452.1|  Homo sapiens haplotype H1 mitochondrion, compl...  3.056e+04  0.0 
gb|EU080974.1|  Homo sapiens haplotype H1 mitochondrion, compl...  3.056e+04  0.0 
gb|EF609014.1|  Homo sapiens haplotype H* mitochondrion, compl...  3.056e+04  0.0 
gb|EF472971.1|  Homo sapiens haplotype H* mitochondrion, compl...  3.056e+04  0.0 
gb|EF177446.1|  Homo sapiens isolate TA22 mitochondrion, compl...  3.056e+04  0.0 
gb|AY739000.1|  Homo sapiens isolate Tor61(#90) mitochondrion,...  3.056e+04  0.0 
gb|AY339406.1|  Homo sapiens isolate F5 (PO23) mitochondrion, ...  3.056e+04  0.0 
gb|AF346981.1|  Homo sapiens mitochondrion, complete genome        3.056e+04  0.0 
gb|AY495105.2|  Homo sapiens isolate H1-16 mitochondrion, comp...  3.056e+04  0.0 
gb|AY495174.1|  Homo sapiens isolate H5-10 mitochondrion, comp...  3.056e+04  0.0 
gb|AY495150.1|  Homo sapiens isolate H3-05 mitochondrion, comp...  3.056e+04  0.0 
gb|AY495148.1|  Homo sapiens isolate H3-03 mitochondrion, comp...  3.056e+04  0.0 
gb|AY495140.1|  Homo sapiens isolate H2-20 mitochondrion, comp...  3.056e+04  0.0 
gb|AY495132.1|  Homo sapiens isolate H2-12 mitochondrion, comp...  3.056e+04  0.0 
gb|AY495126.1|  Homo sapiens isolate H2-06 mitochondrion, comp...  3.056e+04  0.0 
gb|AY495115.1|  Homo sapiens isolate H1-26 mitochondrion, comp...  3.056e+04  0.0 
gb|AY495110.1|  Homo sapiens isolate H1-21 mitochondrion, comp...  3.056e+04  0.0 
gb|AY495104.1|  Homo sapiens isolate H1-15 mitochondrion, comp...  3.056e+04  0.0 
gb|AY495099.1|  Homo sapiens isolate H1-10 mitochondrion, comp...  3.056e+04  0.0 
gb|AY495093.1|  Homo sapiens isolate H1-04 mitochondrion, comp...  3.056e+04  0.0 
gb|EU156036.2|  Homo sapiens haplotype H10 mitochondrion, comp...  3.055e+04  0.0 
gb|FJ719303.1|  Homo sapiens isolate Alg6402 mitochondrion, co...  3.055e+04  0.0 
gb|FJ711775.1|  Homo sapiens haplogroup H1 mitochondrion, comp...  3.055e+04  0.0 
gb|GU266613.1|  Homo sapiens haplogroup H mitochondrion, compl...  3.055e+04  0.0 
gb|FJ236983.1|  Homo sapiens isolate MOR2047 mitochondrion, co...  3.055e+04  0.0 
gb|FJ236981.1|  Homo sapiens isolate SEV1179 mitochondrion, co...  3.055e+04  0.0 
gb|FJ210721.1|  Homo sapiens haplotype H* mitochondrion, compl...  3.055e+04  0.0 
gb|EU677425.1|  Homo sapiens haplotype H* mitochondrion, compl...  3.055e+04  0.0 
gb|EU597524.1|  Homo sapiens isolate NA15727 mitochondrion, co...  3.055e+04  0.0 
gb|EF609012.1|  Homo sapiens haplotype H16 mitochondrion, comp...  3.055e+04  0.0 
gb|EF177413.1|  Homo sapiens isolate AT09 mitochondrion, compl...  3.055e+04  0.0 
gb|AY495103.1|  Homo sapiens isolate H1-14 mitochondrion, comp...  3.055e+04  0.0 
gb|AY495098.1|  Homo sapiens isolate H1-09 mitochondrion, comp...  3.055e+04  0.0 
gb|GQ472310.1|  Homo sapiens haplogroup H mitochondrion, compl...  3.055e+04  0.0 
gb|FJ460534.1|  Homo sapiens isolate TC15 mitochondrion, compl...  3.055e+04  0.0 
gb|FJ348196.1|  Homo sapiens isolate ST026 mitochondrion, comp...  3.055e+04  0.0 
gb|FJ464462.1|  Homo sapiens haplogroup H* mitochondrion, comp...  3.055e+04  0.0 
gb|EU714270.1|  Homo sapiens haplotype H1e mitochondrion, comp...  3.055e+04  0.0 
gb|EU600355.1|  Homo sapiens isolate Druze=144 mitochondrion, ...  3.055e+04  0.0 
gb|EU600345.1|  Homo sapiens isolate Druze=318 mitochondrion, ...  3.055e+04  0.0 
gb|EU600344.1|  Homo sapiens isolate Druze=96 mitochondrion, c...  3.055e+04  0.0 
gb|EU684000.1|  Homo sapiens haplotype H* mitochondrion, compl...  3.055e+04  0.0 
gb|EU670874.1|  Homo sapiens haplotype H* mitochondrion, compl...  3.055e+04  0.0 
gb|EU543281.1|  Homo sapiens haplotype H* mitochondrion, compl...  3.055e+04  0.0 
gb|EU262984.1|  Homo sapiens haplotype H1 mitochondrion, compl...  3.055e+04  0.0 
gb|EU170619.1|  Homo sapiens haplotype H16 mitochondrion, comp...  3.055e+04  0.0 
gb|EU130942.1|  Homo sapiens haplotype H1a mitochondrion, comp...  3.055e+04  0.0 
gb|EF660953.1|  Homo sapiens isolate PA_EU_IT_0041 mitochondri...  3.055e+04  0.0 
gb|EF660931.1|  Homo sapiens isolate PA_EU_IT_0020 mitochondri...  3.055e+04  0.0 
gb|EF660913.1|  Homo sapiens isolate PA_EU_IT_0002 mitochondri...  3.055e+04  0.0 
gb|EF581833.1|  Homo sapiens haplotype H7 mitochondrion, compl...  3.055e+04  0.0 
gb|EF526076.1|  Homo sapiens haplotype H1 mitochondrion, compl...  3.055e+04  0.0 
gb|EF493867.1|  Homo sapiens haplotype H* mitochondrion, compl...  3.055e+04  0.0 
gb|EF408656.1|  Homo sapiens haplotype H7 mitochondrion, compl...  3.055e+04  0.0 
gb|EF376015.1|  Homo sapiens haplotype H1 mitochondrion, compl...  3.055e+04  0.0 
gb|EF363133.1|  Homo sapiens haplotype H* mitochondrion, compl...  3.055e+04  0.0 
gb|EU597538.1|  Homo sapiens isolate HGDP01255 mitochondrion, ...  3.055e+04  0.0 
gb|EU597492.1|  Homo sapiens isolate HGDP00163 mitochondrion, ...  3.055e+04  0.0 
gb|EF660919.1|  Homo sapiens isolate PA_EU_IT_0008 mitochondri...  3.055e+04  0.0
« Последнее редактирование: 06 Апрель 2010, 02:35:42 от Vadim Verenich »

Оффлайн Anode

  • Группа N
  • *
  • Сообщений: 1500
  • Страна: ca
  • Рейтинг +145/-0
  • PS1 -> TT1 -> EE1 -> PS2
  • Y-ДНК: N1c1
  • мтДНК: H10a1, U5b1
Re: Филогенетическое дерево митогаплогруппы H
« Ответ #4 : 06 Апрель 2010, 02:35:57 »
И еще. Я был бы признателен если бы кто-то подготовил выборку из митосиквенсов H, которые по результатам прогонки BLAST поиска в Генбанки показали самые высокие очки по выравниванию.

Все эти сиквенсы можно скачать в формате FASTA (включая header) и засунуть в один файл. Тогда я бы мог построить более полное и точное дерево H. Но лучше всего было бы вытащить все митосиквенсы H из Генбанка.
...

фаста имеет такой формат:
------8<------
>N76300,HVR2,CR,HVR1
GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTATGCACGC
GATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTA
TCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAAAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATA
ACAATTGAATGTCTGCACAGCCGCTTTCCACACAGACATCATAACAAAAAATTTCCACCAAACCCCCCCCTCCCCCCGCT
...
------8<------
, где строки - 80 символов.

А как вам надо?
Все файлы просто объединить?
Или и объединить также строки?
Но как тогда различные генотипы разделить - если один файл?

Оффлайн I2a1aАвтор темы

  • ...
  • Сообщений: 10999
  • Страна: ee
  • Рейтинг +755/-8
Re: Филогенетическое дерево митогаплогруппы H
« Ответ #5 : 06 Апрель 2010, 02:45:47 »
фаста имеет такой формат:
------8<------
>N76300,HVR2,CR,HVR1
GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTATGCACGC
GATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTA
TCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAAAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATA
ACAATTGAATGTCTGCACAGCCGCTTTCCACACAGACATCATAACAAAAAATTTCCACCAAACCCCCCCCTCCCCCCGCT
...


Нет, эта фаста наверное в формате FTDNA,  а мне нужна FASTA в формате Genbank.
Вот например как выглядит Ваш сиквенс в генбанковском формате fasta. Просто копируете сиквенс начиная с хидэра (знак >) до самого конца сиквенса, и вставляете в обычный текстовой файл.
И так далее.Строчки объединять не надо, важно чтобы скопировали в таком виде, в каком сиквенс приведен на сайте.
Каждый новый сиквенс начинается с новой строки,но без пробелов между двумя соседними сиквенсами.
http://www.ncbi.nlm.nih.gov/nuccore/292597388?report=fasta&log$=seqview

Оффлайн napobo3

  • Сообщений: 1336
  • Страна: il
  • Рейтинг +337/-2
  • קַח-נָא אֶת-בִּנְךָ אֶת-יְחִידְךָ אֲשֶׁר-אָהַבְתָּ, אֶת-יִצְחָק
  • Y-ДНК: J-FGC5231
  • мтДНК: N1b2
Re: Филогенетическое дерево митогаплогруппы H
« Ответ #6 : 06 Апрель 2010, 03:04:29 »
Никаких копи-пэйстов, там есть кнопка Download >> FASTA

Вот Вам десяток фаст :
http://napobo3.lk.net/dna/FASTAs.zip

Таблица что-сделано-что-осталось :
http://spreadsheets.google.com/ccc?key=0AjnH-bSBYrYTdExsLW5CTUVXcnJ3SGl2cjhmQnhvMWc&hl=en

« Последнее редактирование: 06 Апрель 2010, 03:33:38 от napobo3 »

Оффлайн Anode

  • Группа N
  • *
  • Сообщений: 1500
  • Страна: ca
  • Рейтинг +145/-0
  • PS1 -> TT1 -> EE1 -> PS2
  • Y-ДНК: N1c1
  • мтДНК: H10a1, U5b1
Re: Филогенетическое дерево митогаплогруппы H
« Ответ #7 : 06 Апрель 2010, 03:29:03 »
сейчас ремонт завершаю (надо срочно закончить, а я тут бегаю смотрю на деревья: гораздо более интересно:), а вообще надо написать скрипт, который выкачает всё по вашему списку или по какому-то критерию.
Единственное что надо исследовать - как добраться УРЛом до их "download FASTA" (там жабаскрипт). Можно захватить все запросы сетевым сканером, например. Но может кто знает прямой УРЛ? Тогда скрипт просто подстановкой генбанковского ID из скиска Вадима в УРЛ - выкачает и соединит все файлы. (я побежал, вернусь чуть позже.)

Оффлайн napobo3

  • Сообщений: 1336
  • Страна: il
  • Рейтинг +337/-2
  • קַח-נָא אֶת-בִּנְךָ אֶת-יְחִידְךָ אֲשֶׁר-אָהַבְתָּ, אֶת-יִצְחָק
  • Y-ДНК: J-FGC5231
  • мтДНК: N1b2
Re: Филогенетическое дерево митогаплогруппы H
« Ответ #8 : 06 Апрель 2010, 03:38:11 »
сейчас ремонт завершаю (надо срочно закончить, а я тут бегаю смотрю на деревья: гораздо более интересно:), а вообще надо написать скрипт, который выкачает всё по вашему списку или по какому-то критерию.
Единственное что надо исследовать - как добраться УРЛом до их "download FASTA" (там жабаскрипт). Можно захватить все запросы сетевым сканером, например. Но может кто знает прямой УРЛ? Тогда скрипт просто подстановкой генбанковского ID из скиска Вадима в УРЛ - выкачает и соединит все файлы. (я побежал, вернусь чуть позже.)

http://www.ncbi.nlm.nih.gov//sviewer/viewer.fcgi?tool=portal&db=nuccore&val=187960977&dopt=fasta&sendto=on&log$=seqview
val=187960977 - из колонки B в таблице http://bit.ly/napobo3-H-FGS

Складываем все эти val= (a.k.a. GI) в файл и генерим скрипт для загрузки фастафайлов:
mkdir -p /var/tmp/H-FASTA-1 ; for i in `cat /var/tmp/H`; do printf "/usr/sfw/bin/wget -O /var/tmp/H-FASTA-1/%s %shttp://www.ncbi.nlm.nih.gov/sviewer/viewer.fcgi?tool=portal&db=nuccore&val=%s&dopt=fasta&sendto=on&log$=seqview%s\n" $i \" $i \" >> /tmp/go ; done && sh /tmp/go && echo done

100 FASTA's : http://napobo3.lk.net/dna/H-FASTA-1.tar.bz2

По-моему - хороший задел для журнальной статьи.
Ваше слово, Вадим.
Запускайте Мурку.
« Последнее редактирование: 06 Апрель 2010, 04:13:02 от napobo3 »

Онлайн Mich Glitch

  • Genus regis
  • Сообщений: 34614
  • Страна: ca
  • Рейтинг +2952/-47
  • Y-ДНК: J2b1
  • мтДНК: H6a1a5a
Re: Филогенетическое дерево митогаплогруппы H
« Ответ #9 : 06 Апрель 2010, 04:10:01 »
То же с добавлением бабушки napobo3a.

Сразу отмечу, что у Вас все таки неполное совпадение (хотя Мич утверждал обратное) -есть одна мутация в 5302 T>C.
И опять, не просто неверное утверждение, а неверное утверждение в квадрате.  :o
Мич Глич не просто утверждал, что полное совпадение отсутствует, но и указал не на 1 (одно), а на 3 (три) различия:

Всего три отличия от меня.
В моей подписи присутствуют также
16093Y
309.2C
5302C

Грубо говоря, 16566 из 16569.
При средней скорости 3·10?6 мутации на маркер на поколение, имеем для доверительной вероятности 50% 14 поколений до общего предка. Т.е. 1530 - 1600 гг.р.

Может именно по этой линии у меня пересечение и с Yulita?

Просто парово3ов папа выпал за рамки релфайндера.
Он кстати протестирован у 23эндМи?

ТщательнЕе, Вадим. ТщательнЕе. ©

:)

Оффлайн Anode

  • Группа N
  • *
  • Сообщений: 1500
  • Страна: ca
  • Рейтинг +145/-0
  • PS1 -> TT1 -> EE1 -> PS2
  • Y-ДНК: N1c1
  • мтДНК: H10a1, U5b1
Re: Филогенетическое дерево митогаплогруппы H
« Ответ #10 : 06 Апрель 2010, 04:34:56 »
Складываем все эти val= (a.k.a. GI) в файл и генерим скрипт для загрузки фастафайлов:
mkdir -p /var/tmp/H-FASTA-1 ; for i in `cat /var/tmp/H`; do printf "/usr/sfw/bin/wget -O /var/tmp/H-FASTA-1/%s %shttp://www.ncbi.nlm.nih.gov/sviewer/viewer.fcgi?tool=portal&db=nuccore&val=%s&dopt=fasta&sendto=on&log$=seqview%s\n" $i \" $i \" >> /tmp/go ; done && sh /tmp/go && echo done

100 FASTA's : http://napobo3.lk.net/dna/H-FASTA-1.tar.bz2


Отлично, и УРЛ есть, и вообще Вы меня опередили, паровоЗ. (i++).
(продолжаю заниматься ремонтом)

Оффлайн I2a1aАвтор темы

  • ...
  • Сообщений: 10999
  • Страна: ee
  • Рейтинг +755/-8
Re: Филогенетическое дерево митогаплогруппы H
« Ответ #11 : 06 Апрель 2010, 12:30:23 »


Сразу отмечу, что у Вас все таки неполное совпадение (хотя Мич утверждал обратное) -есть одна мутация в 5302 T>C.
И опять, не просто неверное утверждение, а неверное утверждение в квадрате.  :o
Мич Глич не просто утверждал, что полное совпадение отсутствует, но и указал не на 1 (одно), а на 3 (три) различия:

Всего три отличия от меня.
В моей подписи присутствуют также
16093Y
309.2C
5302C

Грубо говоря, 16566 из 16569.

ОК, но 2 из 3 приходятся на HVR1 и HVR2, использование митобаз которых при построении филогенетического дерева, не приветствуется. Поэтому основная мутация  5302C из контрольного региона, и именно она увеличивает существенным образом время разделения ветвей до 2 500 лет.

Оффлайн I2a1aАвтор темы

  • ...
  • Сообщений: 10999
  • Страна: ee
  • Рейтинг +755/-8
Re: Филогенетическое дерево митогаплогруппы H
« Ответ #12 : 06 Апрель 2010, 14:22:13 »
Добавил еще несколько сиквенсов из списка Леона. Со времен увеличу до сотни.
На этот раз укоренение дерева производил не по сиквенсам H* или CRS, а по  митосиквенсам "кузинных субкладов" R0a и V2 (хотя наверное надо было брать сиквенсы HV как предковые).

Узлы обозначал не гаплогруппами, а кодами сиквенсов в Генбанке (кроме сиквенса Анода и Митча, обозначенным по имени).

Результат: за счет укоренения через "сестринские" субклады, возраст всех H приблизился к тому, который предпологается в научной литературе (LCA -28 000 лет, этим же возрастом кстати датируется древнейшее найденное мито-дДНК H).

« Последнее редактирование: 06 Апрель 2010, 16:00:57 от Vadim Verenich »

Оффлайн kindsvaters

  • Сообщений: 175
  • Рейтинг +20/-0
    • Ahnen und Nachkommen von Joh. Hartmann Kindsvatter, K?fermeister aus Herxheim/Berg, Gfs. Leiningen
  • Y-ДНК: R1b1b2a1a2d3a
  • мтДНК: H5a1
Re: Филогенетическое дерево митогаплогруппы H
« Ответ #13 : 06 Апрель 2010, 15:17:37 »
Вадим, может и мой FGS в древе учтёте? Мой сиквенс в Генбанке HM027912. Спасибо!

Оффлайн I2a1aАвтор темы

  • ...
  • Сообщений: 10999
  • Страна: ee
  • Рейтинг +755/-8
Re: Филогенетическое дерево митогаплогруппы H
« Ответ #14 : 06 Апрель 2010, 15:26:46 »
Всего три отличия от меня.
В моей подписи присутствуют также
16093Y
309.2C
5302C

Грубо говоря, 16566 из 16569.
При средней скорости 3·10?6 мутации на маркер на поколение, имеем для доверительной вероятности 50% 14 поколений до общего предка. Т.е. 1530 - 1600 гг.р.

Может именно по этой линии у меня пересечение и с Yulita?

Просто парово3ов папа выпал за рамки релфайндера.
Он кстати протестирован у 23эндМи?

ТщательнЕе, Вадим. ТщательнЕе. ©


Все бы ничего, если бы дело ограничивалось двумя мутациями в высокополиморфичных гипервариабельных регионах (HVR1 -309.2C; HVR2 -16093Y). Тогда действительно можно было бы предполагать, что дистанция между Вашим митосиквенсом и митосиквенсом бабушки Леона составляет около 500-1000 лет.
Но поскольку у Вас есть и третья мутация в кодирующем регионе 5302 T>C, то из-за относительно низкой скорости мутаций в этом регионе, дистанция сразу же сдвигается к рубежу 2500 лет.

 

© 2007 Молекулярная Генеалогия (МолГен)

Внимание! Все сообщения отражают только мнения их авторов.
Все права на материалы принадлежат их авторам (владельцам) и сетевым изданиям, с которых они взяты.


Rambler's Top100