АвторТема: позиция снипа  (Прочитано 253 раз)

0 Пользователей и 1 Гость просматривают эту тему.

Оффлайн nilogovАвтор темы

  • Сообщений: 922
  • Страна: ru
  • Рейтинг +62/-2
  • философ антиязыка
  • Y-ДНК: R-BY55151
  • мтДНК: T2b-T152C!
позиция снипа
« : 12 Июль 2020, 15:56:41 »
Подскажите, а как понять точную позицию в игрек-хромосоме для снип-мутации? То есть позицию конкретного нуклеотид по номеру? Используются позиции по Hg19 и по Hg38 (я так понял, что это разная глубина покрытия? А в итоге на какой конкретно месте произошла эта мутация?)

Вот, например, для R-YP417
M12415 / FGC20517 / YP417 / V3192   G    в    A

ChrY позиция (Hg19):   15868478 (+strand)
ChrY позиция (Hg38):   13756598 (+strand) ◄

Онлайн TK

  • Сообщений: 506
  • Страна: ru
  • Рейтинг +362/-0
Re: позиция снипа
« Ответ #1 : 12 Июль 2020, 18:42:08 »
Подскажите, а как понять точную позицию в игрек-хромосоме для снип-мутации? То есть позицию конкретного нуклеотид по номеру? Используются позиции по Hg19 и по Hg38 (я так понял, что это разная глубина покрытия? А в итоге на какой конкретно месте произошла эта мутация?)

Вот, например, для R-YP417
M12415 / FGC20517 / YP417 / V3192   G    в    A

ChrY позиция (Hg19):   15868478 (+strand)
ChrY позиция (Hg38):   13756598 (+strand) ◄

Hg19 и hg38 - это лишь разные "сборки" референсных геномов. Что это значит?
Достоверно никому пока неизвестна точная последовательность оснований в геномах.
Предположим, нас интересует место, где основания встречаются в таком порядке: ACGTACGT.
Когда-то, учёные, на основании исследований, пришли к выводу, что такая последовательность встречается в y-хромосоме, начиная с позиции 22543210. Ну, можно сказать, что так договорились (при существовавшем уровне изучения генома). Это, скажем, были времена hg19.
Прошло несколько лет. Способы исследований совершенствовались и учёные поняли, что перед этой позицией ранее они рассматривали большой кусок, который на самом деле располагался не перед интересующим нас участком, а после него. Таких правок накопилось много и был сделан новый референсный геном - hg38.
Соответственно, позиции интересующих нас снипов поменялись (например, стала  20543210). На самом деле, все равно осталось точно неизвестно, где они, но договорившись о позициях, мы всегда сможем найти снипы по результатам исследований - ведь они будут окружены другими основаниями, о положении которых есть договоренность (эти последовательности и есть hg19 или hg38 (или ещё многие другие)).

Оффлайн nilogovАвтор темы

  • Сообщений: 922
  • Страна: ru
  • Рейтинг +62/-2
  • философ антиязыка
  • Y-ДНК: R-BY55151
  • мтДНК: T2b-T152C!
Re: позиция снипа
« Ответ #2 : 12 Июль 2020, 18:49:14 »
Подскажите, а как понять точную позицию в игрек-хромосоме для снип-мутации? То есть позицию конкретного нуклеотид по номеру? Используются позиции по Hg19 и по Hg38 (я так понял, что это разная глубина покрытия? А в итоге на какой конкретно месте произошла эта мутация?)

Вот, например, для R-YP417
M12415 / FGC20517 / YP417 / V3192   G    в    A

ChrY позиция (Hg19):   15868478 (+strand)
ChrY позиция (Hg38):   13756598 (+strand) ◄

Hg19 и hg38 - это лишь разные "сборки" референсных геномов. Что это значит?
Достоверно никому пока неизвестна точная последовательность оснований в геномах.
Предположим, нас интересует место, где основания встречаются в таком порядке: ACGTACGT.
Когда-то, учёные, на основании исследований, пришли к выводу, что такая последовательность встречается в y-хромосоме, начиная с позиции 22543210. Ну, можно сказать, что так договорились (при существовавшем уровне изучения генома). Это, скажем, были времена hg19.
Прошло несколько лет. Способы исследований совершенствовались и учёные поняли, что перед этой позицией ранее они рассматривали большой кусок, который на самом деле располагался не перед интересующим нас участком, а после него. Таких правок накопилось много и был сделан новый референсный геном - hg38.
Соответственно, позиции интересующих нас снипов поменялись (например, стала  20543210). На самом деле, все равно осталось точно неизвестно, где они, но договорившись о позициях, мы всегда сможем найти снипы по результатам исследований - ведь они будут окружены другими основаниями, о положении которых есть договоренность (эти последовательности и есть hg19 или hg38 (или ещё многие другие)).

Спасибо за подробный ответ! Я думал, что тут всё точно, и раз научились секвенировать геномы целиком, то одну игрек-хромосому и подавно, а оказывается, что мы оперируем неточностями. Так а конкретные необратимые замены нуклеотидов, которые мы называем снипами, всё-таки определяются даже при таком разбросе в позициях на игрек-хромосоме?

Онлайн TK

  • Сообщений: 506
  • Страна: ru
  • Рейтинг +362/-0
Re: позиция снипа
« Ответ #3 : 12 Июль 2020, 18:59:27 »
Позиции снипов легко однозначно определяются по соседним последовательностям.
Например, если в референсе последовательность gggacgtacgtacgtggg, то такой длинной очередности в другом месте днк просто нигде нет.
Есть, например, gggacgtggg, есть gggacgtacgtggg, но они отличаются!
Соответственно, при сравнении результатов анализа с референсом легко определяется снип, так как его окружающие снипы совпадут, например, если встретим gggacgtacgGacgtggg, то скажем, что в том месте, где была последовательность такая-то, на позиции такой-то одно основание поменялось на иное - и вот он, снип.
« Последнее редактирование: 13 Июль 2020, 13:36:40 от TK »

Оффлайн nilogovАвтор темы

  • Сообщений: 922
  • Страна: ru
  • Рейтинг +62/-2
  • философ антиязыка
  • Y-ДНК: R-BY55151
  • мтДНК: T2b-T152C!
Re: позиция снипа
« Ответ #4 : 13 Июль 2020, 16:19:34 »
Позиции снипов легко однозначно определяются по соседним последовательностям.
Например, если в референсе последовательность gggacgtacgtacgtggg, то такой длинной очередности в другом месте днк просто нигде нет.
Есть, например, gggacgtggg, есть gggacgtacgtggg, но они отличаются!
Соответственно, при сравнении результатов анализа с референсом легко определяется снип, так как его окружающие снипы совпадут, например, если встретим gggacgtacgGacgtggg, то скажем, что в том месте, где была последовательность такая-то, на позиции такой-то одно основание поменялось на иное - и вот он, снип.

Принцип понятен. А в чём всё-таки проблема вычисления точной позиции конкретного снипа в игрек-хромосоме? Речь ведь идёт о практически необратимых мутациях?

Онлайн TK

  • Сообщений: 506
  • Страна: ru
  • Рейтинг +362/-0
Re: позиция снипа
« Ответ #5 : 13 Июль 2020, 22:36:40 »
Позиции снипов легко однозначно определяются по соседним последовательностям.
Например, если в референсе последовательность gggacgtacgtacgtggg, то такой длинной очередности в другом месте днк просто нигде нет.
Есть, например, gggacgtggg, есть gggacgtacgtggg, но они отличаются!
Соответственно, при сравнении результатов анализа с референсом легко определяется снип, так как его окружающие снипы совпадут, например, если встретим gggacgtacgGacgtggg, то скажем, что в том месте, где была последовательность такая-то, на позиции такой-то одно основание поменялось на иное - и вот он, снип.

Принцип понятен. А в чём всё-таки проблема вычисления точной позиции конкретного снипа в игрек-хромосоме? Речь ведь идёт о практически необратимых мутациях?

Тут я не понимаю, а в чем проблема-то?
Да, мы не знаем точного строения ДНК - лишь максимально правдоподобно. Да, у хромосомы, в-общем-то, нет начала и конца - ну, или скажем, он бывает разной длины (см. термин Теломеры, например). В составе разных хромосом много одинаковых участков, длина которых может отличаться или вообще просто менять свою позицию в ДНК (см. термин Транспозоны).
Ежели же мы имеем (в общем-то, по договоренности) референсный геном (фактически, мы условились где что считать расположенным "по стандарту), то точное место в интересующих нас случаях мы вполне сможем определить. Главное при этом - указать референс, который нами используется.
Тут и получается, что для одного референса позиция будет X, для другого Y, а скоро будет новый референс - в нём будет позиция Z. И все поймут, про какой снип идёт речь, ибо договорились о референсном геноме.

Оффлайн nilogovАвтор темы

  • Сообщений: 922
  • Страна: ru
  • Рейтинг +62/-2
  • философ антиязыка
  • Y-ДНК: R-BY55151
  • мтДНК: T2b-T152C!
Re: позиция снипа
« Ответ #6 : 14 Июль 2020, 05:54:42 »
Позиции снипов легко однозначно определяются по соседним последовательностям.
Например, если в референсе последовательность gggacgtacgtacgtggg, то такой длинной очередности в другом месте днк просто нигде нет.
Есть, например, gggacgtggg, есть gggacgtacgtggg, но они отличаются!
Соответственно, при сравнении результатов анализа с референсом легко определяется снип, так как его окружающие снипы совпадут, например, если встретим gggacgtacgGacgtggg, то скажем, что в том месте, где была последовательность такая-то, на позиции такой-то одно основание поменялось на иное - и вот он, снип.

Принцип понятен. А в чём всё-таки проблема вычисления точной позиции конкретного снипа в игрек-хромосоме? Речь ведь идёт о практически необратимых мутациях?

Тут я не понимаю, а в чем проблема-то?
Да, мы не знаем точного строения ДНК - лишь максимально правдоподобно. Да, у хромосомы, в-общем-то, нет начала и конца - ну, или скажем, он бывает разной длины (см. термин Теломеры, например). В составе разных хромосом много одинаковых участков, длина которых может отличаться или вообще просто менять свою позицию в ДНК (см. термин Транспозоны).
Ежели же мы имеем (в общем-то, по договоренности) референсный геном (фактически, мы условились где что считать расположенным "по стандарту), то точное место в интересующих нас случаях мы вполне сможем определить. Главное при этом - указать референс, который нами используется.
Тут и получается, что для одного референса позиция будет X, для другого Y, а скоро будет новый референс - в нём будет позиция Z. И все поймут, про какой снип идёт речь, ибо договорились о референсном геноме.

Удивительно, конечно! Я подозревал, что раз научились секвинировать геномы, то уж одну игрек-хромосому должны были изучить вдоль и поперёк, а оказывается - всё так зыбко. Ставит ли это под сомнение вообще всю методологию снипов как реперных точек для определения общих предков и возрастов?

Оффлайн nilogovАвтор темы

  • Сообщений: 922
  • Страна: ru
  • Рейтинг +62/-2
  • философ антиязыка
  • Y-ДНК: R-BY55151
  • мтДНК: T2b-T152C!
Re: позиция снипа
« Ответ #7 : 14 Июль 2020, 11:01:04 »
Позиции снипов легко однозначно определяются по соседним последовательностям.
Например, если в референсе последовательность gggacgtacgtacgtggg, то такой длинной очередности в другом месте днк просто нигде нет.
Есть, например, gggacgtggg, есть gggacgtacgtggg, но они отличаются!
Соответственно, при сравнении результатов анализа с референсом легко определяется снип, так как его окружающие снипы совпадут, например, если встретим gggacgtacgGacgtggg, то скажем, что в том месте, где была последовательность такая-то, на позиции такой-то одно основание поменялось на иное - и вот он, снип.

Принцип понятен. А в чём всё-таки проблема вычисления точной позиции конкретного снипа в игрек-хромосоме? Речь ведь идёт о практически необратимых мутациях?

Тут я не понимаю, а в чем проблема-то?
Да, мы не знаем точного строения ДНК - лишь максимально правдоподобно. Да, у хромосомы, в-общем-то, нет начала и конца - ну, или скажем, он бывает разной длины (см. термин Теломеры, например). В составе разных хромосом много одинаковых участков, длина которых может отличаться или вообще просто менять свою позицию в ДНК (см. термин Транспозоны).
Ежели же мы имеем (в общем-то, по договоренности) референсный геном (фактически, мы условились где что считать расположенным "по стандарту), то точное место в интересующих нас случаях мы вполне сможем определить. Главное при этом - указать референс, который нами используется.
Тут и получается, что для одного референса позиция будет X, для другого Y, а скоро будет новый референс - в нём будет позиция Z. И все поймут, про какой снип идёт речь, ибо договорились о референсном геноме.

У меня вопрос прежде всего по онтологическому статусу этих снипов. Значит они точно существуют? Но последовательности из нуклеотидов в игрек-хромосоме - плавающие? Поэтому нет чёткости в определении позиции снипа. Как тут исключить обратимость замены в данной позиции (поправка на обратимость мутации), если мы пытаемся идентифицировать конкретного общего предка, у которого случилась эта конкретная необратимая мутация.
« Последнее редактирование: 14 Июль 2020, 14:34:15 от nilogov »

Онлайн TK

  • Сообщений: 506
  • Страна: ru
  • Рейтинг +362/-0
Re: позиция снипа
« Ответ #8 : 14 Июль 2020, 14:43:37 »
У меня вопрос прежде всего по онтологическому статусу этих снипов. Значит они точно существуют? Но последовательности из нуклеотидов в игрек-хромосоме - плавающая? Поэтому нет чёткости в определении позиции снипа. Как тут исключить обратимость замены в данной позиции (поправка на обратимость мутации), если мы пытаемся идентифицировать конкретного общего предка, у которого случилась эта конкретная необратимая мутация.

Для волнений нет оснований. Давайте посмотрим на "раскрашенную" Y-хромосому.

Credit: Genome Decoration Page/NCBI

В ней есть разные области (раскраска - не полная, конечно же, но основная). Уже даже такое деление как бы намекает, что есть разные области, которые надо рассматривать!

В начале расположены Теломеры - в их составе повторяющиеся последовательности типа TTAGGG (в цикле). При каждом цикле репликации их длина уменьшается (так как ДНК-полимераза не в состоянии реплицировать с самого края - ну, так уж оно устроено). Даже их наличие будет означать, что у одного индивида в одной клетке теломера, например, имеет длину 600 оснований, а в соседней клетке - 594 основания.
Или, например, область синего цвета, подписанная q12 - это вообще "полный атас" - основания там расположены как попало и до сих пор непонятно, чего от нее ждать (ну, я конечно, утрирую - есть исследования, которые находят там куски полезных РНК и всякое-всякое).
Соответственно, встает вопрос - а с какого числа начать считать основания?
С 1 или с 7 ? Чтобы у разных клеток потом (когда теломеры закончатся и начнется осмысленный текст ДНК) - позиции у результатов совпали?

Но как бы то ни было, потом-то рано или поздно, начинается "осмысленный текст" - и вот уже он слабо подвержен мутациям.
Разумеется, осмысленный текст перемежается другими "вставками" (не осмысленными или слабо осмысленными).

Так, YP417 располагается как раз в такой "благопристойной" зоне, в районе q11.221
Последовательность, которая там расположена, достаточно уникальна и другой похожей в геноме не встречается.
Так, если рассмотреть примерно 50 позиций около YP417, то они выглядят так:
у не-мутантов:
GTTCATTGAGTTCAAACATCTAGGAATGCAACAATAAAGACTTGAGTTTCTGC
у мутантов с YP417:
GTTCATTGAGTTCAAACATCTAGGAATACAACAATAAAGACTTGAGTTTCTGC

Основания, расположенные рядом с YP417, сохраняют свою очередность при передаче потомкам.
Это, можно сказать, стабильный регион и именно наличие их делает возможным то, чем мы тут все страдаем занимаемся.
Ну и договорились (скажем так), что в hg38 позиция места этого снипа будет 13756598.

Соответственно, если в результате анализа кого-то находится последовательность (и мы не знаем, где она была в ДНК - может, вообще из другой хромосомы):
CATCTAGGAATACAACAATAAAGACT (я взял кусочек поменьше, чем 50 оснований)
то при анализе смотрится, - А откуда она могла быть взята - давайте сравним по всему геному, где она лучше всего может "совпасть".
И говорится - Ага, мы нашли последовательность для области снипа YP417 (все соседние совпадают с теми, что должны быть возле него), да и на самом месте снипа имеется A вместо G - значит, это кусочек ДНК человека с YP417.

YFull в свое время дополнительно анализировал стабильность разных регионов Y-ДНК, чтобы среди "стабильных" регионов определить те, которые можно использовать для расчета возрастов TMRCA. Но это уже "бантики" как бы.
« Последнее редактирование: 14 Июль 2020, 16:02:35 от TK »

Оффлайн nilogovАвтор темы

  • Сообщений: 922
  • Страна: ru
  • Рейтинг +62/-2
  • философ антиязыка
  • Y-ДНК: R-BY55151
  • мтДНК: T2b-T152C!
Re: позиция снипа
« Ответ #9 : 14 Июль 2020, 18:34:38 »
У меня вопрос прежде всего по онтологическому статусу этих снипов. Значит они точно существуют? Но последовательности из нуклеотидов в игрек-хромосоме - плавающая? Поэтому нет чёткости в определении позиции снипа. Как тут исключить обратимость замены в данной позиции (поправка на обратимость мутации), если мы пытаемся идентифицировать конкретного общего предка, у которого случилась эта конкретная необратимая мутация.

Для волнений нет оснований. Давайте посмотрим на "раскрашенную" Y-хромосому.

Credit: Genome Decoration Page/NCBI

В ней есть разные области (раскраска - не полная, конечно же, но основная). Уже даже такое деление как бы намекает, что есть разные области, которые надо рассматривать!

В начале расположены Теломеры - в их составе повторяющиеся последовательности типа TTAGGG (в цикле). При каждом цикле репликации их длина уменьшается (так как ДНК-полимераза не в состоянии реплицировать с самого края - ну, так уж оно устроено). Даже их наличие будет означать, что у одного индивида в одной клетке теломера, например, имеет длину 600 оснований, а в соседней клетке - 594 основания.
Или, например, область синего цвета, подписанная q12 - это вообще "полный атас" - основания там расположены как попало и до сих пор непонятно, чего от нее ждать (ну, я конечно, утрирую - есть исследования, которые находят там куски полезных РНК и всякое-всякое).
Соответственно, встает вопрос - а с какого числа начать считать основания?
С 1 или с 7 ? Чтобы у разных клеток потом (когда теломеры закончатся и начнется осмысленный текст ДНК) - позиции у результатов совпали?

Но как бы то ни было, потом-то рано или поздно, начинается "осмысленный текст" - и вот уже он слабо подвержен мутациям.
Разумеется, осмысленный текст перемежается другими "вставками" (не осмысленными или слабо осмысленными).

Так, YP417 располагается как раз в такой "благопристойной" зоне, в районе q11.221
Последовательность, которая там расположена, достаточно уникальна и другой похожей в геноме не встречается.
Так, если рассмотреть примерно 50 позиций около YP417, то они выглядят так:
у не-мутантов:
GTTCATTGAGTTCAAACATCTAGGAATGCAACAATAAAGACTTGAGTTTCTGC
у мутантов с YP417:
GTTCATTGAGTTCAAACATCTAGGAATACAACAATAAAGACTTGAGTTTCTGC

Основания, расположенные рядом с YP417, сохраняют свою очередность при передаче потомкам.
Это, можно сказать, стабильный регион и именно наличие их делает возможным то, чем мы тут все страдаем занимаемся.
Ну и договорились (скажем так), что в hg38 позиция места этого снипа будет 13756598.

Соответственно, если в результате анализа кого-то находится последовательность (и мы не знаем, где она была в ДНК - может, вообще из другой хромосомы):
CATCTAGGAATACAACAATAAAGACT (я взял кусочек поменьше, чем 50 оснований)
то при анализе смотрится, - А откуда она могла быть взята - давайте сравним по всему геному, где она лучше всего может "совпасть".
И говорится - Ага, мы нашли последовательность для области снипа YP417 (все соседние совпадают с теми, что должны быть возле него), да и на самом месте снипа имеется A вместо G - значит, это кусочек ДНК человека с YP417.

YFull в свое время дополнительно анализировал стабильность разных регионов Y-ДНК, чтобы среди "стабильных" регионов определить те, которые можно использовать для расчета возрастов TMRCA. Но это уже "бантики" как бы.

Теперь понятно! Большое спасибо! Я пытался разобраться с нумерацией между Hg19 и Hg38 на сайте YFull: а в чём между ними принципиальная разница? Порой разница в позиции конкретного снипа доходит до 2 миллионов нуклеотидов - например, позиция была на уровне 15 миллионов, а стала на уровне 13 миллионов.

Оффлайн nilogovАвтор темы

  • Сообщений: 922
  • Страна: ru
  • Рейтинг +62/-2
  • философ антиязыка
  • Y-ДНК: R-BY55151
  • мтДНК: T2b-T152C!
Re: позиция снипа
« Ответ #10 : 14 Июль 2020, 18:41:53 »
А могли бы ещё подсказать, какие конкретно снипы стоят за этой филогенетической цепочкой?

P
P1
P-P337

Начиная со звена P-P226 снипы отслеживаются хорошо, а глубже их становится очень много. Имею в виду, какой реперный снип выбран для классификации гаплогрупп древнее P-P226?

Оффлайн nilogovАвтор темы

  • Сообщений: 922
  • Страна: ru
  • Рейтинг +62/-2
  • философ антиязыка
  • Y-ДНК: R-BY55151
  • мтДНК: T2b-T152C!
Re: позиция снипа
« Ответ #11 : 02 Август 2020, 08:01:17 »
Кто может подсказать, почему разница в позиции конкретного снипа доходит до 2 миллионов нуклеотидов - например, позиция была на уровне 15 миллионов, а стала на уровне 13 миллионов. Меня смущает такой большой разброс в 2 миллиона! Если игрек-хромосома насчитывает всего 57, 2 миллиона нуклеотидов, то разница в 2 миллиона кажется огромной.

Вот, например, для R-YP417
M12415 / FGC20517 / YP417 / V3192   G    в    A

ChrY позиция (Hg19):   15868478 (+strand)
ChrY позиция (Hg38):   13756598 (+strand) ◄

 

© 2007 Молекулярная Генеалогия (МолГен)

Внимание! Все сообщения отражают только мнения их авторов.
Все права на материалы принадлежат их авторам (владельцам) и сетевым изданиям, с которых они взяты.


Rambler's Top100